SGN Marker TG230

SGN-M113

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
ACCCTGTTGTTGCAGAAGCAACCCTTGACTTTCTGAATGCAAACAAGAAAAAGTTTTCAAGTTCATTTCCTACTTTGCTTCCCCAGGTAC
ATATTCAAGTCAAGTTGCCGTTAATTTATTCTAATTTATGGGGGTATAATGCTCAAGACATCAATTGTAAAATAGTAGAATATCATCTTT
GAAAGAGGGTTAATTTGATATAATTATGTGGTACTGTAATTTTTTTGGTCTTGATACAGTGCAGGTGAAGTAAACATCACATCCCCTCTC
CGTTATTTCTGTATTTAATACCGATAAAAAGATGTAATTAGTAATAGATATCACTGTTCTACATCCCTTTGTGCATGTAAGAAATTTTAC
AATCTAAAAAGTAGATGTGACAGCTCTACATGTTAGTATAGACCATCTGTAGCTTTAACACATTGATTCACCCTGATTATTTGAATCATA
TCGCTCGAACCTTATGATGG
Reverse sequence
ATGCAAGAACAAGCAACAGGTTCTACTATCTGAAAATAAATAATGGCTCACTCCATTTAAAACCTATGCAGTTGCCAAAGTCCAAACAAC
AGAGCAGCAACCAATCTATTATTATTAAAATGGCAAATCTTGGTGTCATGTAGTGCAATAAAGGAAATCTATTTTCAGCACAATTTACCA
ACAAAAAAAAGACAATAAGAAGCTGAAAAAAACAAGGATATTGAGCCAAATTACTTTCTTTACAATTCAAAGCCAAAGTTTGATTAGCCA
ATATAAGATACAAGAGAAATAACATAGTACCATAATCTATCCATCCATTGGCATAATTCTATAGAATTTCCCCTTTTTTATTAAAAATTG
AGATATGACAATAAGACTTACTTCTCCCCATTCCATGCAATTAGCTTCAGCAATAAAGGGAAAAACTGCAATGTCATGAGAGATCAGATT
AGCGC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1522283.3e-4286 (18.3% of RFLP seq)+
SGN-U1522286e-1947 (10.3% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53226)
Chromosome
10
Position
35.33 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50355)
Chromosome
10
Position
1.02 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46791)
Chromosome
8
Position
11.20 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42421)
Chromosome
4
Position
21.90 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39951)
Chromosome
10
Position
0.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8151)
Chromosome
4
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8150)
Chromosome
10
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8155)
Chromosome
10
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Other PCR data 
PCR data   Exp. ID 35622
Forward primer (5'-3')
TTGCAGAAGCAACCCTTGAC
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 900
Solanum pennellii LA716: 470
Mg+2 concentration
3mM
Reverse primer (5'-3')
TACTTCTCCCCATTCCATGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Solanum lycopersicum LA925: 1200
Approximate temperature
50°C
  
PCR data   Exp. ID 122
Forward primer (5'-3')
Unknown
Digested band sizes (using DpnII)
Solanum pennellii LA716: 470
Solanum lycopersicum LA925: 900
Mg+2 concentration
3mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Solanum lycopersicum LA925: 1200
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
TG230 was used as an overgo probe on plate 1 [well A10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGTCTTGATACAGTGCAGGTGAAG
B sequence
GGGGATGTGATGTTTACTTCACCT
AB sequence
GGTCTTGATACAGTGCAGGTGAAGTAAACA
Marker sequence
ACCCTGTTGTTGCAGAAGCAACCCTTGACTTTCTGAATGCAAACAAGAAA
AAGTTTTCAAGTTCATTTCCTACTTTGCTTCCCCAGGTACATATTCAAGT
CAAGTTGCCGTTAATTTATTCTAATTTATGGGGGTATAATGCTCAAGACA
TCAATTGTAAAATAGTAGAATATCATCTTTGAAAGAGGGTTAATTTGATA
TAATTATGTGGTACTGTAATTTTTTTGGTCTTGATACAGTGCAGGTGAAG
TAAACATCACATCCCCTCTCCGTTATTTCTGTATTTAATACCGATAAAAA
GATGTAATTAGTAATAGATATCACTGTTCTACATCCCTTTGTGCATGTAA
GAAATTTTACAATCTAAAAAGTAGATGTGACAGCTCTACATGTTAGTATA
GACCATCTGTAGCTTTAACACATTGATTCACCCTGATTATTTGAATCATA
TCGCTCGAACCTTATGATGG
Genomic location of TG230  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D113 marker 113
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)