SGN Marker CT79

SGN-M114

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
750
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT79 image not available
Forward sequence
TTTTTTTTTTTCAGAGCACAAAAAAAATTCAAAAAAATCCTCATCGGAAAATCATGTCGGGGCAAGTATATGTCGACGATCACCTCCTGT
GTGAAATCGAAGGGAACCACCTCAGCGCCGCCGCTATCGTCGGCCTTGACGGCGCTGTTTGGGCTAAAAGCTCAACTTTCCCTCAGTTCA
AACCCTCAGAGATTGATGCCATCCTGAACGATTTTAATGAGCCCGGTTCACTTGCACCAACTGGCCTGCATCTTGGGGGCTCAAAGTACA
TGGTCATTCAAGGGGAACCTGGGGTTGTCATTCGAGGAAAGAAGGGACCGGGGGGTATTACTATCAAAAAGACTAATCAGGCTCTACTTA
TTGGTATCTATGATGAACCAATGACTCCAGGCCAGTGTAACTTGGTTGTTGAAAGGCTCGGTGATTATCTCGTTGAGCAAGGTTATTAAT
Reverse sequence
CTTTTTTTTTTTTGATGAAAAACCCAGGAGCTGTATATTACACAAGCCAAATTTTGTGCAAAGTGAAATCCAGTTATAGGTACCAACAAC
AAATTCCCCTCTCAAAAATAATCAGAGGGTCTCACTTGAAAATAATTTAAACCAATTCTTGCAAAATCAAAATACAAAGAGAGAACTGTT
GAATCCAGAAAGGTATCATATCTAACACTTCCCAACTCTTGAGTATCCATCATCAGCAAACACCACAATCTTCAATACAAACATATTGAA
AAGAAATTCCAACAAATTAATAACCTTGCTCAACGAGATAATCACCGAGCCTCTCAACAACCAAGTTACACTGGCCTGGAGTCATTGGTT
CATCATAGATACCAATAAGTAGAGCCTGATTAGTCTTTTTGATAGTAATACCACCCGGTCCCTTCTTTCCTC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1447025.3e-10188 (41.8% of RFLP seq)+
SGN-U1447013.4e-11202 (44.9% of RFLP seq)+
SGN-U146118413 (91.8% of RFLP seq)+
SGN-U146118419 (97.0% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53477)
Chromosome
12
Position
10.23 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51905)
Chromosome
12
Position
42.44 cM
Confidence
uncalculated
Protocol
unknown

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42359)
Chromosome
12
Position
21.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39070)
Chromosome
12
Position
32.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8157)
Chromosome
12
Position
30.90 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 8159)
Chromosome
12
Position
21.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8158)
Chromosome
12
Position
28.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8156)
Chromosome
12
Position
17.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
CT79 was used as an overgo probe on plate 16 [well C12]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P077K10,   P076M13,   P149M17

 Overgo Sequences

A sequence
TATGTCGACGATCACCTCCTGTGT
B sequence
GGTTCCCTTCGATTTCACACAGGA
AB sequence
TATGTCGACGATCACCTCCTGTGTGAAATC
Marker sequence
TTTTTTTTTTTCAGAGCACAAAAAAAATTCAAAAAAATCCTCATCGGAAA
ATCATGTCGGGGCAAGTATATGTCGACGATCACCTCCTGTGTGAAATCGA
AGGGAACCACCTCAGCGCCGCCGCTATCGTCGGCCTTGACGGCGCTGTTT
GGGCTAAAAGCTCAACTTTCCCTCAGTTCAAACCCTCAGAGATTGATGCC
ATCCTGAACGATTTTAATGAGCCCGGTTCACTTGCACCAACTGGCCTGCA
TCTTGGGGGCTCAAAGTACATGGTCATTCAAGGGGAACCTGGGGTTGTCA
TTCGAGGAAAGAAGGGACCGGGGGGTATTACTATCAAAAAGACTAATCAG
GCTCTACTTATTGGTATCTATGATGAACCAATGACTCCAGGCCAGTGTAA
CTTGGTTGTTGAAAGGCTCGGTGATTATCTCGTTGAGCAAGGTTATTAAT
Genomic location of CT79  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D114 marker 114
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)