SGN Marker FWA

SGN-M11420

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42978)
Chromosome
12
Position
50.30 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43978
Forward primer (5'-3')
CAAAATGCCTGGGAAAGTGT
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
CTTGACTAGAGAGCATCCCTGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of FWA  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D11420 marker 11420
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)