SGN Marker M13938

SGN-M11422

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42980)
Chromosome
9
Position
76.20 cM
Confidence
uncalculated
Protocol
SSR


Tomato-LXCHM 2007

PCR data   Exp. ID 43980
Forward primer (5'-3')
GAGTCAAAGTTTGCTCACATC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CTCTTCTGAACTTGCTTTGAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of M13938  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D11422 marker 11422
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)