SGN Marker PHYE

SGN-M11426

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42984)
Chromosome
2
Position
21.30 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43984
Forward primer (5'-3')
ATGGAAAGATTGACTGGTTGGACA
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
GACTCACAATAGCATCCACAACAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of PHYE  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D11426 marker 11426
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)