SGN Marker U21085

SGN-M11433

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 43025)
Chromosome
4
Position
26.10 cM
Confidence
uncalculated
Protocol
SSR


Tomato-LXCHM 2007

PCR data   Exp. ID 44025
Forward primer (5'-3')
CATTTTATCATTTATTTGTGTCTTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACAAAAAAAGGTGACGATACA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of U21085  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D11433 marker 11433
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)