SGN Marker LEOH185

SGN-M11458

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43684)
Chromosome
3
Position
75.30 cM
Confidence
uncalculated
Protocol
INDEL


Sun1642 x LA1589

PCR data   Exp. ID 44985
Forward primer (5'-3')
CGTCACAGTCGCGTAAATGA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CCTTCTTCCCCAATTTCCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Assay data  
5' flanking region
GCTCGTCACAGTCGCGTAAATGATTTTAAA
  
3' flanking region
AATTTGTTGAACATCCGAATTCATACCGTT
  
   Indel
AATTTATGAGTTTTG

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43084)
Chromosome
3
Position
63.00 cM
Confidence
uncalculated
Protocol
INDEL


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44864
Forward primer (5'-3')
CGTCACAGTCGCGTAAATGA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CCTTCTTCCCCAATTTCCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Assay data  
5' flanking region
GCTCGTCACAGTCGCGTAAATGATTTTAAA
  
3' flanking region
AATTTGTTGAACATCCGAATTCATACCGTT
  
   Indel
AATTTATGAGTTTTG
Genomic location of LEOH185  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D11458 marker 11458
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)