SGN Marker LEOH342

SGN-M11474

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43701)
Chromosome
2
Position
55.70 cM
Confidence
uncalculated
Protocol
INDEL


Sun1642 x LA1589

PCR data   Exp. ID 44989
Forward primer (5'-3')
TCCTTTGATTGTTTCAACACC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCCACAACTCCCTGAAAAGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Assay data  
5' flanking region
AACGGTTCATTATAACCCCCAAGTTTTTTT
  
3' flanking region
CTTTTGGTGTTTTATGATCTTTATAACAAC
  
   Indel
T
Genomic location of LEOH342  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D11474 marker 11474
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)