SGN Marker SL10075_405

SGN-M11498

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43530)
Chromosome
7
Position
40.90 cM
Confidence
uncalculated
Protocol
SNP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43124)
Chromosome
7
Position
42.60 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
TAAAACAATTGCAGGCTAAGTTGCTTGGTC
ASPE primers (5'-3')
GCTAAGTTGCTTGGTCC
GCTAAGTTGCTTGGTCT
3' flanking region
CCCCAAAATGTTGCCAGAGCCGTGTTGGAT
SNP nucleotide
CT
SNPdb format
TAAAACAATTGCAGGCTAAGTTGCTTGGTC[C/T]
CCCCAAAATGTTGCCAGAGCCGTGTTGGAT
  
Genomic location of SL10075_405  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D11498 marker 11498
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)