Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

SGN Marker SL10136_628

SGN-M11508

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43718)
Chromosome
4
Position
107.90 cM
Confidence
uncalculated
Protocol
SNP


Sun1642 x LA1589

Assay data  
5' flanking region
TAGATTGAGAATTATTCAGTGATTGCTAAG
ASPE primers (5'-3')
GTTAGGCCCATCCTTTACCC
GTTAGGCCCATCCTTTACCT
3' flanking region
GGTAAAGGATGGGCCTAACTCTTAACACGA
SNP nucleotide
AG
SNPdb format
TAGATTGAGAATTATTCAGTGATTGCTAAG[A/G]
GGTAAAGGATGGGCCTAACTCTTAACACGA
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43132)
Chromosome
4
Position
100.00 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
TAGATTGAGAATTATTCAGTGATTGCTAAG
ASPE primers (5'-3')
GTTAGGCCCATCCTTTACCC
GTTAGGCCCATCCTTTACCT
3' flanking region
GGTAAAGGATGGGCCTAACTCTTAACACGA
SNP nucleotide
AG
SNPdb format
TAGATTGAGAATTATTCAGTGATTGCTAAG[A/G]
GGTAAAGGATGGGCCTAACTCTTAACACGA
  
Genomic location of SL10136_628  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D11508 marker 11508
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)