SGN Marker SSR479

SGN-M1152

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 52
Repeat motif: GAGCGA   Repeat number: 2
Repeat motif: GC   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: TGTAAGAGTGTCTGCCTGCAC
Reverse primer: ATGGGTTCGGGTTAGCTCTT
Predicted size: 235
Derivations 
This marker was derived from EST read SGN-E14443
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39252)
Chromosome
10
Position
86.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31725
Forward primer (5'-3')
TGTAAGAGTGTCTGCCTGCAC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ATGGGTTCGGGTTAGCTCTT
Enzymes
  
Accessions and product sizes
Approximate temperature
52°C
  
Overgo hybridization and physical mapping 
SSR479 was used as an overgo probe on plate 14 [well G12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCTCTCTCTCTCTGTGGGTCTATG
B sequence
CAGGCAGACACTCTTACATAGACC
AB sequence
TCTCTCTCTCTCTGTGGGTCTATGTAAGAG
Marker sequence
TGCCAGATGCTCATCAGCAGCTCTCTCTCTCTCTCTCTCTCTGTGGGTCT
ATGTAAGAGTGTCTGCCTGCACGCGCGCGAGCGCGCGCGCGCGCGAGCGA
GAGCGAGCGAGAGACAGAGTCTAGGCCAGGTCAAGGCCAAAACAAGAGAA
AGAGAGAAACAGAAATACAAACACACACACAGACACACACACACACAAAA
AGACAAAGGCAAAGAAAGAAAAAAGCGTGAGATAACGAACGCAAACTATA
GCACTCGATAGAGAACAAGAGCTAACCCGAACCCATCTAAACATATAAAA
GAACACACACACATACACAACCACATACCAACACCGCCAAACACAATCGA
TCGTCTTTCAAAACAAAAGAAAAAAAAGATAACAACTAATACATACACAC
TACAAACATACACAATAAACAAAACATAAACACATACCTTAACACGGAAA
CTCCAAATAAACCAAAAACAAACACTAAAAATGCAATTCAAATACACATT
AACTCAACACAGATTAAATCAGTAACCAAACAAACGATCTACTCAAACAT
CAATACCAGCTCTCCATAAATAACAACAACCAACATTAAACTATAAAAAA
ATATAAAACCCCCCCCCCCCCCATAAAAAATATAAATAATATAATATCAA
AAAATACCCCCACCCCCCCCGAATAAAAAATCTCTTATAATTTCACATCT
AATAAGCAATATAAATAATCACAATCTACGAAACAAAACATCCATCAAAA
ACAACAACACATCTCATATTTAAAATTAAAACCCACCCCCC
Genomic location of SSR479  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1152 marker 1152
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)