SGN Marker SL10385_302

SGN-M11533

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43545)
Chromosome
3
Position
75.10 cM
Confidence
uncalculated
Protocol
SNP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43155)
Chromosome
3
Position
76.70 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
GGATATGCACACTATTTCGGTGTCGTCATC
ASPE primers (5'-3')
CTATTTCGGTGTCGTCATCA
CTATTTCGGTGTCGTCATCG
3' flanking region
AGTTTCTAGGACATATTTTTCCTTGCCAAT
SNP nucleotide
AG
SNPdb format
GGATATGCACACTATTTCGGTGTCGTCATC[A/G]
AGTTTCTAGGACATATTTTTCCTTGCCAAT
  
Genomic location of SL10385_302  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D11533 marker 11533
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)