SGN Marker SL10425_788

SGN-M11542

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43548)
Chromosome
3
Position
97.20 cM
Confidence
uncalculated
Protocol
SNP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43164)
Chromosome
3
Position
98.50 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
CTATAGTTAACTGTATTGGATAATAATTTT
ASPE primers (5'-3')
CTCCACGAAAGTAAAATGCC
CTCCACGAAAGTAAAATGCT
3' flanking region
GCATTTTACTTTCGTGGAGTAGGTTCCCGA
SNP nucleotide
AG
SNPdb format
CTATAGTTAACTGTATTGGATAATAATTTT[A/G]
GCATTTTACTTTCGTGGAGTAGGTTCCCGA
  
Genomic location of SL10425_788  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D11542 marker 11542
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)