SGN Marker SL10437_373

SGN-M11543

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43165)
Chromosome
3
Position
76.10 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
TTAAATTGAAGTTGACCCAAGCAACTTTGG
ASPE primers (5'-3')
GACCCAAGCAACTTTGGA
GACCCAAGCAACTTTGGT
3' flanking region
TTTGGTAGGGTCTTATTGTCTTTAAACACC
SNP nucleotide
AT
SNPdb format
TTAAATTGAAGTTGACCCAAGCAACTTTGG[A/T]
TTTGGTAGGGTCTTATTGTCTTTAAACACC
  
Genomic location of SL10437_373  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D11543 marker 11543
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)