SGN Marker SL10471_963

SGN-M11548

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43551)
Chromosome
9
Position
13.20 cM
Confidence
uncalculated
Protocol
SNP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43170)
Chromosome
9
Position
20.30 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
CAAATAAAATACTACATTGACAAGCAAAAA
ASPE primers (5'-3')
CACATGGAGTGATGTCATG
CACATGGAGTGATGTCATA
3' flanking region
ATGACATCACTCCATGTGTTTTCTAGAATA
SNP nucleotide
CT
SNPdb format
CAAATAAAATACTACATTGACAAGCAAAAA[C/T]
ATGACATCACTCCATGTGTTTTCTAGAATA
  
Genomic location of SL10471_963  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D11548 marker 11548
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)