SGN Marker SL10554_290

SGN-M11555

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43742)
Chromosome
10
Position
62.20 cM
Confidence
uncalculated
Protocol
SNP


Sun1642 x LA1589

Assay data  
5' flanking region
ATAGATGTACAGCAATAAGTTTTAGGAAAG
ASPE primers (5'-3')
ACAGCAATAAGTTTTAGGAAAGA
ACAGCAATAAGTTTTAGGAAAGG
3' flanking region
TAAAACTGTTCTTCATTCTTCAGTATAAAA
SNP nucleotide
AG
SNPdb format
ATAGATGTACAGCAATAAGTTTTAGGAAAG[A/G]
TAAAACTGTTCTTCATTCTTCAGTATAAAA
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43177)
Chromosome
10
Position
55.10 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
ATAGATGTACAGCAATAAGTTTTAGGAAAG
ASPE primers (5'-3')
ACAGCAATAAGTTTTAGGAAAGA
ACAGCAATAAGTTTTAGGAAAGG
3' flanking region
TAAAACTGTTCTTCATTCTTCAGTATAAAA
SNP nucleotide
AG
SNPdb format
ATAGATGTACAGCAATAAGTTTTAGGAAAG[A/G]
TAAAACTGTTCTTCATTCTTCAGTATAAAA
  
Genomic location of SL10554_290  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D11555 marker 11555
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)