SGN Marker SL10560_917

SGN-M11557

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43554)
Chromosome
12
Position
76.10 cM
Confidence
uncalculated
Protocol
SNP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43179)
Chromosome
12
Position
72.00 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
ATGCAAGAAAGTTATAACTAATTGCACGGC
ASPE primers (5'-3')
ATAACTAATTGCACGGCA
ATAACTAATTGCACGGCG
3' flanking region
AAAAATCTTTTCTCAAGAAAATACAAATAG
SNP nucleotide
AG
SNPdb format
ATGCAAGAAAGTTATAACTAATTGCACGGC[A/G]
AAAAATCTTTTCTCAAGAAAATACAAATAG
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of SL10560_917  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D11557 marker 11557
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)