SGN Marker SL10737_1414i

SGN-M11572

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43754)
Chromosome
11
Position
60.00 cM
Confidence
uncalculated
Protocol
INDEL


Sun1642 x LA1589

PCR data   Exp. ID 45025
Forward primer (5'-3')
CCACTCCTGGGACTCAAATC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGGACCCACAGGTAATGAGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Assay data  
5' flanking region
GAATATATACACAATTGTCTTTACGCTAGT
  
3' flanking region
AGTTTCAACAAAGGGATTATACCAGAGCCC
  
   Indel
TTCAAACGCT

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43193)
Chromosome
11
Position
46.40 cM
Confidence
uncalculated
Protocol
INDEL


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44904
Forward primer (5'-3')
CCACTCCTGGGACTCAAATC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGGACCCACAGGTAATGAGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Assay data  
5' flanking region
GAATATATACACAATTGTCTTTACGCTAGT
  
3' flanking region
AGTTTCAACAAAGGGATTATACCAGAGCCC
  
   Indel
TTCAAACGCT
Genomic location of SL10737_1414i  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D11572 marker 11572
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)