SGN Marker SL10772i

SGN-M11574

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43756)
Chromosome
3
Position
104.50 cM
Confidence
uncalculated
Protocol
INDEL


Sun1642 x LA1589

PCR data   Exp. ID 45026
Forward primer (5'-3')
TGCAAAAACATATCGCAATTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GAGGGTCATTTCAGTAGACAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Assay data  
5' flanking region
AGCATGAACTGCGTTTGATAACCATGATTA
  
3' flanking region
TTTTGTTCTTTTGAAAAAAGTGCAATGATG
  
   Indel
TTT

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43195)
Chromosome
3
Position
94.90 cM
Confidence
uncalculated
Protocol
INDEL


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44905
Forward primer (5'-3')
TGCAAAAACATATCGCAATTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GAGGGTCATTTCAGTAGACAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Assay data  
5' flanking region
AGCATGAACTGCGTTTGATAACCATGATTA
  
3' flanking region
TTTTGTTCTTTTGAAAAAAGTGCAATGATG
  
   Indel
TTT
Genomic location of SL10772i  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D11574 marker 11574
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)