SGN Marker SL10831_391

SGN-M11583

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43561)
Chromosome
11
Position
42.70 cM
Confidence
uncalculated
Protocol
SNP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43204)
Chromosome
11
Position
48.50 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
AAAAGGTCAAAATAACCTGATCGTGTAAAA
ASPE primers (5'-3')
GTTATATGCATCGATAGGGTTAAT
GTTATATGCATCGATAGGGTTAAC
3' flanking region
TTAACCCTATCGATGCATATAACTTAGATA
SNP nucleotide
AG
SNPdb format
AAAAGGTCAAAATAACCTGATCGTGTAAAA[A/G]
TTAACCCTATCGATGCATATAACTTAGATA
  
Genomic location of SL10831_391  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D11583 marker 11583
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)