SGN Marker SL10939_959

SGN-M11590

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43566)
Chromosome
2
Position
28.70 cM
Confidence
uncalculated
Protocol
SNP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43211)
Chromosome
2
Position
40.70 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
ACGTGCATTCATGACAGACGAAGGGCTTAT
ASPE primers (5'-3')
ACAGACGAAGGGCTTATG
ACAGACGAAGGGCTTATT
3' flanking region
AATAAGTTTAATACCAAACGAGTGAGGTCC
SNP nucleotide
GT
SNPdb format
ACGTGCATTCATGACAGACGAAGGGCTTAT[G/T]
AATAAGTTTAATACCAAACGAGTGAGGTCC
  
Genomic location of SL10939_959  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D11590 marker 11590
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)