SGN Marker SL20097_454

SGN-M11603

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43571)
Chromosome
5
Position
49.80 cM
Confidence
uncalculated
Protocol
SNP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43223)
Chromosome
5
Position
49.40 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
TGTATGTGGAACAGCTAGTCCTTTCAAGTC
ASPE primers (5'-3')
CAGCTAGTCCTTTCAAGTCA
CAGCTAGTCCTTTCAAGTCT
3' flanking region
TGAGGGTTATGATGAATGKTCTTTCTAAT
SNP nucleotide
ACTT
SNPdb format
TGTATGTGGAACAGCTAGTCCTTTCAAGTC[A/T]
TGAGGGTTATGATGAATGKTCTTTCTAAT
  
Genomic location of SL20097_454  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D11603 marker 11603
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)