Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

SGN Marker SSR488

SGN-M1161

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 53
Repeat motif: ACA   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: CCGATGGTCCACTTGAAAC
Reverse primer: CGGAAGAAGAATCCTGAGCA
Predicted size: 242
Derivations 
This marker was derived from EST read SGN-E15514
Mapped locationsNone
Other PCR data 
PCR data   Exp. ID 31816
Forward primer (5'-3')
CCGATGGTCCACTTGAAAC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CGGAAGAAGAATCCTGAGCA
Enzymes
  
Accessions and product sizes
Approximate temperature
53°C
  
Overgo hybridization and physical mapping 
SSR488 was used as an overgo probe on plate 9 [well F4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAGAATCAGAGGAAGCAGAGGATG
B sequence
GGTGTTTCCGACAAACCATCCTCT
AB sequence
GAGAATCAGAGGAAGCAGAGGATGGTTTGT
Marker sequence
TGCCCGATGGTCCACTTGAAACNCNACCCCATCGTTTTTTTTTTTTTTTT
TTTACCAAATCAATCAGGTTGATAATAATTGTCATTCAAGAGAAAATTAC
TTGTTCTAATGAACTGAAGATAATAAGCACACAACAACAACAACAACAAC
AACTTAGCAACAGAAAAACACACTTATACATGAACATTACACCGCTATTT
AATCTTAGAAAAAAACCTGAAACTATGCTCAGGATTCTTCTTCCGCGGGG
CATTCTCACTGAATCAGACTCGATAAAAATGGATTATCGCGCTTTCCCTG
ACTTGTCTTTTCCCATTTCCATCTTCAAATATAGTACTTGTTCCTGTCAG
GTTATAATGGGAGATTGTGTTTCCGAGCTGATTCAATGACGAGAATCAGA
GGAAGCAGAGGATGGTTTGTCGGAAACACCATCATGCTCCTACTGTATTT
CACCTTGGATTCGTGTAGGAATGCGAAAGCCAGAGAATCCGCCTAAATTG
TGAGGCGAATCCCATGCCAGAAAGTGATGTTGGAAACATAAGAAACACAA
CTTTGATGATAGTTTGGGTTTTGGGGATTGGATCACACTGGGCGAATGCA
AACCCTGTTGGTCTATTCCTGCCGAAACGAGGTGAGTACTGGGCTGAGGG
GCCCCTTTTGACAAAACTGGTTTGGGGACCATGTGTATACGCGGGGAGGT
GGGGAAAAAAAACTTCTGTCAAAATTGCCCCCACAGGTTCCAGGGGCGCG
GGCCAATAACGGTGTGTGGGTGGGCCCTGAGCTAACCGAGAATTTGGGTA
ACGGCTGGGTTGAAAGAAAAGGTAAATGGTTGAAAAATGGTTAAAGGAGA
CCCTTACCCCCCCGAAAGAGGGAAACCCTCCGGGCCATATTTNTTCTTTT
Genomic location of SSR488  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1161 marker 1161
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)