SGN Marker SL20268_1315i

SGN-M11614

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43577)
Chromosome
1
Position
41.70 cM
Confidence
uncalculated
Protocol
INDEL


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43234)
Chromosome
1
Position
61.30 cM
Confidence
uncalculated
Protocol
INDEL


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44924
Forward primer (5'-3')
CACTCCGTTCCTTGGCATAC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CCCTTCCGTTCTTAAATACTTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Assay data  
5' flanking region
GGGTAATTATCCTTATTTATTACTTCTCTA
  
3' flanking region
TTTTGAACCATTTTAATATCTCTCCATATA
  
   Indel
TTTAATTTTTCTCTC
Genomic location of SL20268_1315i  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D11614 marker 11614
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)