SGN Marker TG520

SGN-M119

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG520 image not available
Forward sequence
AGGATCACAACAAGAATATTGCCCTGGAAAATAACAGCTGAGCAAACTGGAATTCCTAAGTAAAAGCAGACGCTATATGTGATTCATAGT
GAGACGAAATAACCAGTTCCTACTCCATCACAAAAAGAGACAGGTGGTATCATTTTCTATATCAACATGTATGGAGTTTTTTCAAGGCCT
ATGTAAGATCGAGCATCATGCAAAATGCACACACCCAGAGTAATAGCAAATAACAGTGTAAATTCATAGAATCACACATTTTGGTATAAA
ATCAGCATACCTACGGGTATAAAGGTGAAATCTGCAATCCTTTTCTCTATGGTCCTGACTACTTTATCTTGTCCCCTGGAAAGAAATGTT
CCCGAACTTGTTCGAACCCTGCCAGGGAGGTTTATTAGTTAAAGCAGTGACAATCGAGATGAACAAGCACACGAATTGCTTACCTGCTAT
CTGTACTCTTGCCAGT
Reverse sequence
TCTTTATTTACTCAATGCACCCCAGGTTTGCTCGATTGAGATTACTATATTGACATGATATTCATTCATGGATATTGGATACTACTTCTA
TAAGGGTAATGTAATATTCTTTCGTGATGGTCAGGAAGACTGTCATGTGTAGGATTTGAGAAATTCTTGCATTTGATTTTTTTTACTACA
CAAATTTGGGAAGGGCACATTACTTATGAATTTGGGTAAGATACAAATCAATATAGATAGCTCAACTGACGTAATGAAATGAAAAAAAAT
CAAAATAACTTCATAACGATGGCAACACTTGATTCCTGCGTTCTTCTTTCTTTTAATCAGCATTGGTATCTCTATGCAATTTGCTTTTGC
ACTGTGCCACTATGAGAAACCAAATACATTTCTCTGTCATTCAAGACCATGTGGATCACTTAAACTTGGTTTTCAGCAATCATCAATAAT
ATTGAGGAAACTAGTGCCGATATTGATTCAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1583513.3e-0524 (5.2% of RFLP seq)+
SGN-U1583511.3e-0728 (6.0% of RFLP seq)+
SGN-U1508163.4e-0837 (7.9% of RFLP seq)+
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43876)
Chromosome
3
Position
36.00 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43615)
Chromosome
3
Position
32.60 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43338)
Chromosome
3
Position
32.80 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42482)
Chromosome
3
Position
41.90 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40880)
Chromosome
3
Position
37.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36585
Forward primer (5'-3')
AATCATCAATAATATTGAGGAAACTAGGG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGCATCTTTTCTTCCCCTTTT
Digested band sizes (using HaeIII)
Solanum lycopersicum TA209
125
Solanum pennellii TA56
162
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Eggplant-LXM 2002   
Map version
29 (location: 8184)
Chromosome
3
Position
45.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8183)
Chromosome
3
Position
49.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG520 was used as an overgo probe on plate 4 [well F6]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TGTCCCCTGGAAAGAAATGTTCCC
B sequence
GGGTTCGAACAAGTTCGGGAACAT
AB sequence
TGTCCCCTGGAAAGAAATGTTCCCGAACTT
Marker sequence
AGGATCACAACAAGAATATTGCCCTGGAAAATAACAGCTGAGCAAACTGG
AATTCCTAAGTAAAAGCAGACGCTATATGTGATTCATAGTGAGACGAAAT
AACCAGTTCCTACTCCATCACAAAAAGAGACAGGTGGTATCATTTTCTAT
ATCAACATGTATGGAGTTTTTTCAAGGCCTATGTAAGATCGAGCATCATG
CAAAATGCACACACCCAGAGTAATAGCAAATAACAGTGTAAATTCATAGA
ATCACACATTTTGGTATAAAATCAGCATACCTACGGGTATAAAGGTGAAA
TCTGCAATCCTTTTCTCTATGGTCCTGACTACTTTATCTTGTCCCCTGGA
AAGAAATGTTCCCGAACTTGTTCGAACCCTGCCAGGGAGGTTTATTAGTT
AAAGCAGTGACAATCGAGATGAACAAGCACACGAATTGCTTACCTGCTAT
CTGTACTCTTGCCAGT
Genomic location of TG520  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D119 marker 119
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)