SGN Marker TG52

SGN-M12

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2100
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AGTCGACCTGCAGAAACTCCAACCATCTTCTAGTACTCTTCATTTGAGCAAAACACAGATCAGATAGTAGAAGAATAACCATATTCTATT
ATATGAAAAAAAAAATTCATTCTTCCAGAAGGTAGCATGTAGTACCAGTTTCATGCTAGCACTATCCAGTGATGAGAAATAGAAGACAGA
CGTACTCTGAGGTGACTACCTGCTTTAATCCTAGCATACTCCCACCCACATTTCCCATCCGATTTCTCTCTTGATTTTCTGCATTTTTAA
AAGAAAGTGGTTTCCTGCATTTCTTTAACCCGTCAGATCTGGTTTCTATCTCTCCTCATTAGAGAACCATTTTTCCTTAAACCTGATCAA
TTCTTCCGTTCAATCATCCCTCCAGCCTATTTGATATTCTCTCCTT
Reverse sequence
AACAAATGTCAACTGTCTCTACACATAAACAGCTGTTGTGAGTTGTGACTCAGACGATATTTCTCTTTCTCAAGTTTTCATGGGTCAGTA
CAATCTTCTTTGCTTGCAGCCATGAGAAGCATGCTACCTTCAGAGGTGTTCTGGCTTTCCACACTTGTTTCCATGGCCACTTTTTGGTTA
GTGGAAAGGTCATGTCAAGAGTCTTCTACCCTGAACTCACTTTGTAAACCCCTTTTCTGAGTCCATTCCACCATAATCCGTTCATCCCAT
CCTTTAGCCCTTATAAGGTTTCAAGTGTTTTAAGAGTTCAAGCAATCTTTGGATATCCCAGTCATTCAAGCTTTTTCTGAAAATTAACTC
CCAACCT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53347)
Chromosome
10
Position
46.89 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7727)
Chromosome
10
Position
32.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 7728)
Chromosome
10
Position
4.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG52 was used as an overgo probe on plate 15 [well H8]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P013N24,   P200K10,   P091N05,   P109J10,   P086E23,   P205K10,   P074L20,   P206F18,   P308I01,   P126L22,   P118F14,   P123I07,   P043I09,   P149C06,   P047H17,   P265M11,   P051E09,   P181I18

 Overgo Sequences

A sequence
TCCTAGCATACTCCCACCCACATT
B sequence
GAGAAATCGGATGGGAAATGTGGG
AB sequence
TCCTAGCATACTCCCACCCACATTTCCCAT
Marker sequence
AGTCGACCTGCAGAAACTCCAACCATCTTCTAGTACTCTTCATTTGAGCA
AAACACAGATCAGATAGTAGAAGAATAACCATATTCTATTATATGAAAAA
AAAAATTCATTCTTCCAGAAGGTAGCATGTAGTACCAGTTTCATGCTAGC
ACTATCCAGTGATGAGAAATAGAAGACAGACGTACTCTGAGGTGACTACC
TGCTTTAATCCTAGCATACTCCCACCCACATTTCCCATCCGATTTCTCTC
TTGATTTTCTGCATTTTTAAAAGAAAGTGGTTTCCTGCATTTCTTTAACC
CGTCAGATCTGGTTTCTATCTCTCCTCATTAGAGAACCATTTTTCCTTAA
ACCTGATCAATTCTTCCGTTCAATCATCCCTCCAGCCTATTTGATATTCT
CTCCTT
Genomic location of TG52  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D12 marker 12
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)