SGN Marker TG165

SGN-M120

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1700
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TAGAAATGGATAAAAAAGAAAGTTATCCAACATCATGCAAGCTTCTAAATGCTTACCATAATGAGGTTGCTAATAAATTGAGTGCATTTT
AAGCTACATCAAACACTGCCAATTTCCAATTTCAACAAAACCGAGAATCAAGGAAATATTGGTTTTATCAATGTTTCTGTCCTCTGCCTG
CATGATAATCCATGACAGCATTGATGACGAACACTAATGTGATCCAGAATCAAAAAGCAAACATATACTCAATTTGATGGACCATCTCAT
CCAACAGATAAGGACAAAGATTATTTACGTTTTAACATGCTCCTAAGCCGTGAAAATACGTTGTTATTAACTAAAAAACACTTGAAGAAT
ATTAGATTGTATGACCAGTCATATCCCAAAAACTCAAGTTGTTCTAAAAATGGTACACTCATATGTACCAAGTCTGCAACACATAACTCC
AAATAATTGAGCGACTAACATGATTAAGGAG
Reverse sequence
TGTTTGAATGTTGAAACACAGACACCTCAACTCCACAATCACTACCTGGGAAAAGAATTCATCCAAAAAGCCTCCAAAAGCTCATCCCAG
TTATGGATTGATTAAGCTGGAACAAACCATCTTTTTGATCCCTTGGTAACAAACCATCAACCTTTAAAGTTGAAGGTGAATGATGTGTAT
TACATGAACAACCTCCTCTTATAGTTAATCTCATGCTATATCAATGGTTTTAACGAATTCAACCATTAAGTGAGAACATGCAATTTCCAC
TTTGAAGTTCTCTATAATTTGAGTATCAATAATTTTTATGTTAACGGTTATTTGGTTGCTAGGATACATGAAATAAATTAGGATATTTTA
TGAGATTAATTTCCACCTTTTATACCAGATA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43839)
Chromosome
2
Position
21.50 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43588)
Chromosome
2
Position
19.10 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43299)
Chromosome
2
Position
31.40 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42412)
Chromosome
2
Position
12.20 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40839)
Chromosome
2
Position
28.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Eggplant-LXM 2002   
Map version
29 (location: 8186)
Chromosome
2
Position
13.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8185)
Chromosome
2
Position
25.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8187)
Chromosome
2
Position
26.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG165 was used as an overgo probe on plate 16 [well D5]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TCTGCCTGCATGATAATCCATGAC
B sequence
GTTCGTCATCAATGCTGTCATGGA
AB sequence
TCTGCCTGCATGATAATCCATGACAGCATT
Marker sequence
TAGAAATGGATAAAAAAGAAAGTTATCCAACATCATGCAAGCTTCTAAAT
GCTTACCATAATGAGGTTGCTAATAAATTGAGTGCATTTTAAGCTACATC
AAACACTGCCAATTTCCAATTTCAACAAAACCGAGAATCAAGGAAATATT
GGTTTTATCAATGTTTCTGTCCTCTGCCTGCATGATAATCCATGACAGCA
TTGATGACGAACACTAATGTGATCCAGAATCAAAAAGCAAACATATACTC
AATTTGATGGACCATCTCATCCAACAGATAAGGACAAAGATTATTTACGT
TTTAACATGCTCCTAAGCCGTGAAAATACGTTGTTATTAACTAAAAAACA
CTTGAAGAATATTAGATTGTATGACCAGTCATATCCCAAAAACTCAAGTT
GTTCTAAAAATGGTACACTCATATGTACCAAGTCTGCAACACATAACTCC
AAATAATTGAGCGACTAACATGATTAAGGAG
Genomic location of TG165  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D120 marker 120
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)