SGN Marker TG523

SGN-M121

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AAAACATGGAAGAGGAGGATTTCAGTCCTGTAGATGTTGATTTCAATCTTGTAAAGAATTTCCTGGATTCGTTTTCTTCTCAAGATGGAC
TTCCAGGACCTGCTTCTAACTTGCTTGGACTTATGGGTCTACAGCTACCACCAGATGCTAGCAAAGGGAAATAACCATATTATACACAAA
CTTGTTTCCTCATTCTTCTTTTCCTTGCCTTTTTCTAAACGGCAATCTTTACAATACTATGTATTACGTATGTTTTAACTTCAAACGGAG
AAAAAAGGAGGAGGTGGATTTATGTGGTATTTTCCATTTTTGACCATCAAATAATTTATATATTGATAAATTATGTAAAAAATATTATAA
GTTGACGAAATTTATCATGACCAGGAAGTGAAGTAGTAGGTTTTGGTTGTGACTTTTTGACTTAGAACATCAAATTTGGAATAAT
Reverse sequence
TGCTGCAAATGAAGATAAAAGACCACATTCACAAAACTCACTTTTAACCTGAAAGGAGAAAAAACATGAAGGAAATACTAACCAGGAACC
AACTCAGATTCATCTGTTCCAGCGATACAATGAGGAGGATTAGGTGGCTCAGGCACATCAGGATGATGCGAATCACGAAGTGCATAAATA
GGCCATTTCTTCTCACAGAACACTTTTGCAAGTTTAACTGACTCATCAACCATTGCTGAAATTTGTCTATTTGGTGTCACCGGAGCCTAT
AGCAAAACAAATGGCACAAAATCACAATCTAACTGATATATGAGGAATAAGAATCACATGAATTGCTTAGCGAAACTAACGAGTTATCCA
CTATAGTCACAAAAATAGTCGAAAAACAAACATTAGAACAACATACGAATAGAAAGAGAGAGAGAACAAAACAACTCAAAAAAGATAACA
TAGATTGAATGAAGCTCCTTACTGG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1527893.1e-0540 (9.0% of RFLP seq)+
SGN-U1560563e-101185 (38.9% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53348)
Chromosome
11
Position
6.39 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_11 MQTL_1_Maturity_11 MQTL_2_Late_blight_11 MQTL_2_Maturity_11
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50405)
Chromosome
11
Position
3.71 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48338)
Chromosome
11
Position
43.66 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42483)
Chromosome
11
Position
12.60 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40881)
Chromosome
11
Position
25.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36586
Forward primer (5'-3')
TGGGTCTACAGCTACCACCA
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
GCGAATCACGAAGTGCATAA
Digested band sizes (using BamHI)
Solanum pennellii TA56
2300
Solanum lycopersicum TA209
1800
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40076)
Chromosome
11
Position
29.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 8194)
Chromosome
12
Position
0.00 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8189)
Chromosome
11
Position
21.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 8191)
Chromosome
11
Position
11.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8190)
Chromosome
11
Position
27.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8188)
Chromosome
11
Position
2.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG523 was used as an overgo probe on plate 10 [well C5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGCTTGGACTTATGGGTCTACAGC
B sequence
CTAGCATCTGGTGGTAGCTGTAGA
AB sequence
TGCTTGGACTTATGGGTCTACAGCTACCAC
Marker sequence
AAAACATGGAAGAGGAGGATTTCAGTCCTGTAGATGTTGATTTCAATCTT
GTAAAGAATTTCCTGGATTCGTTTTCTTCTCAAGATGGACTTCCAGGACC
TGCTTCTAACTTGCTTGGACTTATGGGTCTACAGCTACCACCAGATGCTA
GCAAAGGGAAATAACCATATTATACACAAACTTGTTTCCTCATTCTTCTT
TTCCTTGCCTTTTTCTAAACGGCAATCTTTACAATACTATGTATTACGTA
TGTTTTAACTTCAAACGGAGAAAAAAGGAGGAGGTGGATTTATGTGGTAT
TTTCCATTTTTGACCATCAAATAATTTATATATTGATAAATTATGTAAAA
AATATTATAAGTTGACGAAATTTATCATGACCAGGAAGTGAAGTAGTAGG
TTTTGGTTGTGACTTTTTGACTTAGAACATCAAATTTGGAATAAT
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG523  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D121 marker 121
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)