SGN Marker TG167

SGN-M122

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG167 image not available
Forward sequence
AAGAATCGTCTTGTGTGAGCGATTCGTTTATAGAGAGAGGTGTGGTGAGATCGCGAGAGCGAGTTGAGTGTATATCCTACGATTTCCACT
CTCCGCTAATCAATTTGTCAGACAAGTTTTCGTTACCATGTCGGAGAAGAAGCTTGTGGTAAGTTTTGGTTTCTTTCTTGATTTTCAAGG
CATGTTTGTCTTTGATTGCAATCTTAATGTGATTGCTTCTTGATTTTTAGGTTTTAGGCATCCCATGGGACGTGGATACAGAAGGTCTAA
GGGAATATATGATCAAATATGGAGATTTAGAGGATTGTATTGTGATGAAGGTCAGTCTACGCAGCTACCTTGACTTTTATGATATGCATT
GTTTCAGATATACTGTAGTTCCAAAGACTTTCATGACCTAACTGTGTGCAGTCTTGTTTTTTGTGTTGACAATGTTGTTTCTTTTTTTGT
TTGTTAATTGTGCTTGTATCAGAAAA
Reverse sequence
AAAATTAAAAAAAACAGACCATAAAATAAGAACAGAGGAATCACTAACAGAGTAATAGGAAGCTGGGCACATTGACCTACTAAAAAAAAG
AAGAGAAGAAGATGAAGAAGCAAAAAAAAGAGCAGCTGACTATGGCAGAAGAGAAGCTGCAAAGCAGAGGAGAAAGAAGAAGAAGACGTA
ACTAAAGGCTGAAGCTGAGGAGAAGAGAGTCACGTGTCAAAGAGAAAATTGAAGAAGAGAGTCGTGAGTCACGTTTGTTTTTAAAAACAC
TAATATTGCCATTTAATTATTAAGCACGTTTGTTTTTTTTCAAAAAGAATAAAATAAAAGGGCAACAATGGTGCCACCTCACCACTCATC
ATTTCTCGCCATTGATCGCCTTTGCAGGGTTGCGCCTTACGAGTAATAGGCGCAAAATCTCTGGCCAAAGGCAATCGCATTTGATAATCT
GGTTTACTTTACCAGGAAAGAACCCAACGCAATCTTGAATC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1648881.4e-1033 (6.9% of RFLP seq)+
SGN-U1648882.4e-52151 (31.7% of RFLP seq)+
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53873)
Chromosome
2
Position
80.30 cM
Confidence
uncalculated
Protocol
RFLP

Dry_matter_weight_dmw2_1 Titratable_acidity_ta2_1 Eugenol_content_eug2_1 Fruit_weight_fw2_1Soluble_solid_content_ssc2_1 Sugar_content_suc2_1 3_Methylthio_propanal_content_mta2_1 Hex_3_en_1_ol_content__x3o2_1 Fruit_diameter_fd2_1 Color_a_a2_1 Dry_matter_weight_dmw2_2 Sugar_content_suc2_2 Soluble_solid_content_ssc2_2 Color_L_L2_1 Fruit_weight_fw2_2Titratable_acidity_ta2_2 Dry_matter_weight_dmw2_3 Color_b_b2_1Fruit_diameter_fd2_2 Elasticity_ela2_1 Carotene_content_car2_1 2_Isobutylthiazole_content_ibt2_1
Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53193)
Chromosome
2
Position
83.18 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_2 MQTL_2_Late_blight_2 MQTL_3_Late_blight_2
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43840)
Chromosome
2
Position
42.10 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43300)
Chromosome
2
Position
94.90 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39920)
Chromosome
2
Position
118.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8196)
Chromosome
2
Position
104.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8199)
Chromosome
2
Position
88.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG167 was used as an overgo probe on plate 6 [well C2]

Plausible BAC Matches:   P104A12,   P316K19,   P266G08

 Overgo Sequences

A sequence
ATAGAGAGAGGTGTGGTGAGATCG
B sequence
ACTCAACTCGCTCTCGCGATCTCA
AB sequence
ATAGAGAGAGGTGTGGTGAGATCGCGAGAG
Marker sequence
AAGAATCGTCTTGTGTGAGCGATTCGTTTATAGAGAGAGGTGTGGTGAGA
TCGCGAGAGCGAGTTGAGTGTATATCCTACGATTTCCACTCTCCGCTAAT
CAATTTGTCAGACAAGTTTTCGTTACCATGTCGGAGAAGAAGCTTGTGGT
AAGTTTTGGTTTCTTTCTTGATTTTCAAGGCATGTTTGTCTTTGATTGCA
ATCTTAATGTGATTGCTTCTTGATTTTTAGGTTTTAGGCATCCCATGGGA
CGTGGATACAGAAGGTCTAAGGGAATATATGATCAAATATGGAGATTTAG
AGGATTGTATTGTGATGAAGGTCAGTCTACGCAGCTACCTTGACTTTTAT
GATATGCATTGTTTCAGATATACTGTAGTTCCAAAGACTTTCATGACCTA
ACTGTGTGCAGTCTTGTTTTTTGTGTTGACAATGTTGTTTCTTTTTTTGT
TTGTTAATTGTGCTTGTATCAGAAAA
Genomic location of TG167  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D122 marker 122
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)