SGN Marker TG525

SGN-M123

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2000
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CAAATTCACCACTCTGGGAACAGACCTGGTCAATGATACAGAAGGCATGGAGTAAGAAAGCACTGAGTTGCACCCCAATAGTATTTCTTG
AGCTCTATCAGTTCACCTCCCAGCATCACTGATCATCTTGATTCTTGACTATGCATATTGGTAGCAGTACAGTTCCTCCCTTTATGGACT
GCCTCTTTAGCTTAGCAATCATGTGGATCTTGTGAAGGATATAAGAGAATTTTCGAATGTTTAGAGGATGGCTATTTACACTCAAAGTAT
ATCCCCTCATTTCTAGTTTCTTGTTGGTGCATTTATGAATACAGAAGATAGCTCGTCCTTTATAGAGAATCATAGTGTTGTAGGTCCTCT
ACTGTTGATTAATTGCTAGGTTAAGGAGATCCAAATTTTTAATAGAAGTAATTGTCTTGGCAAAAAAATGATCACCATTCACATGATTGG
CTTCTTTTTGTAGAGCAGGGGTACAATATTG
Reverse sequence
CCGCTCAACCCTAAACCTTCCTCTCTCTACTCTTCCACCTTTACCCCTCCCAATTCCTTGTCTCCCAAAACCCTAAAACCCATTCCGGCC
TTCAGGCCTTCTAGAAACTTCTACCCTTCCATCCATTCTATGCTCCAGTACAACCGCAAGCCTCAACTCGCCGGAGATACGCCGAGAGTC
GTCGTCATTACATCCGGCAAAGGCGGCGTCGGGAAGACCACTACCACCGCCAACATCGGTCTTTCATTAGCTAGGCTCGGCTTCTCTGTC
GTCGCCATTGATTGCGATGTTGGTCTCCGCAACCTTGACCTCCTCCTGGGCTTAGAAAACCGGGTGAATTATACTGTTGTCGAGGTTCTC
AACGGTGATTGCAGACTAGATCAGGCTCTTGTACGTGATAAGCGGTGGTCCAATTTCGAGCTGCTGTGTATTTCCAAGCCCAGATCCAAA
TTGCCGATAGGGTTTGGTGGGAAAGCTTTGGTTTGGCTTGTGGATGC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U169528463 (93.2% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40882)
Chromosome
3
Position
14.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36587
Forward primer (5'-3')
TATCAGTTCACCTCCCAGCA
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
GCCAATCATGTGAATGGTGAT
Digested band sizes (using Tsp509I)
Solanum pennellii TA56
214
Solanum lycopersicum TA209
230
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8200)
Chromosome
3
Position
47.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8201)
Chromosome
3
Position
15.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG525 was used as an overgo probe on plate 4 [well B1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCTTGAGCTCTATCAGTTCACCTC
B sequence
TGATCAGTGATGCTGGGAGGTGAA
AB sequence
TCTTGAGCTCTATCAGTTCACCTCCCAGCA
Marker sequence
CAAATTCACCACTCTGGGAACAGACCTGGTCAATGATACAGAAGGCATGG
AGTAAGAAAGCACTGAGTTGCACNNNAATAGTATTTCTTGAGCTCTATCA
GTTCACCTCCCAGCATCACTGATCATCTTGATTCTTGACTATGCATATTG
GTAGCAGTACAGTTCCTCCCTTTATGGACTGCCTCTTTAGCTTAGCAATC
ATGTGGATCTTGTGAAGGATATAAGAGAATTTTCGAATGTTTAGAGGATG
GCTATTTACACTCAAAGTATATNNNNNTCATTTCTAGTTTCTTGTTGGTG
CATTTATGAATACAGAAGATAGCTCGTCCTTTATAGAGAATCATAGTGTT
GTAGGTCCTCTACTGTTGATTAATTGCTAGGTTAAGGAGATCCAAATTTT
TAATAGAAGTAATTGTCTTGGCAAAAAAATGATCACCATTCACATGATTG
GCTTCTTTTTGTAGAGCA
Genomic location of TG525  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D123 marker 123
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)