SGN Marker SSR565

SGN-M1238

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 55 High: 55
Repeat motif: GGGGAT   Repeat number: 3
Repeat motif: GAT   Repeat number: 3
Repeat motif: GAG   Repeat number: 2
Repeat motif: AAC   Repeat number: 3
Repeat motif: CAG   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: GAGGATGATGAGAACTCGCC
Reverse primer: TCAGAGGCTTCTGGGTCAGT
Predicted size: 236
Derivations 
This marker was derived from EST read SGN-E150570
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42998)
Chromosome
7
Position
41.50 cM
Confidence
uncalculated
Protocol
SSR


Tomato-LXCHM 2007

PCR data   Exp. ID 43998
Forward primer (5'-3')
GAGGATGATGAGAACTCGCC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCAGAGGCTTCTGGGTCAGT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39262)
Chromosome
7
Position
44.20 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14127
Forward primer (5'-3')
GAGGATGATGAGAACTCGCC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCAGAGGCTTCTGGGTCAGT
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 236+372
Solanum lycopersicum LA925: 236+384
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
SSR565 was used as an overgo probe on plate 1 [well F2]

Plausible BAC Matches:   P075L17,   P137F13,   P107O05,   P214L21,   P179D10,   P268I18,   P028N11,   P023M04,   P241A01,   P316I11,   P080O02,   P312E23,   P189E23,   P275F02,   P068L24,   P016K02,   P153L15,   P180B03,   P299P15,   P260C01,   P073A09,   P121P03,   P180I06,   P117B03,   P071M24,   P095D16,   P300I04,   P298B12,   P123L12,   P054E06,   P016G01,   P236G16,   P280M09,   P114K01,   P169J01,   P289M06,   P169E07,   P001O05,   P150A19,   P059N02,   P285L17,   P290A02,   P168L19,   P311A03,   P171E23,   P298J21,   P009P18,   P272H20

 Overgo Sequences

A sequence
TTGAGGAAGAGGAGGAAGATGAGC
B sequence
TCCTGGGTTTGTTCTTGCTCATCT
AB sequence
TTGAGGAAGAGGAGGAAGATGAGCAAGAAC
Marker sequence
GCGGTGCTCAAGGAAAAATGCCAGCGCAGAAACGATTTTTATCGAATTAT
CAAGATGATGACAACAACGATGAGGATGATGAGAACTCGCCAGAGCAACA
GCAGCAGCAGCAGCAGCAGCACCGTCGCCGGAAACAATCCAGGCGAGCTA
TGGAAGAGGAACAACAACAAGTTGAGGAAGAGGAGGAAGATGAGCAAGAA
CAAACCCAGGATGATGATGGGGATGGGGATGGGGATGATCGANAGGGGAA
AAAGCAATCTTCTGATGATGATTCTGATGGAAGTGGCACTGACCCAGAAG
CCTCTGATGAGTTAATCGCTGTGTCACGATCTGAGATTCGCACCAATGTA
CAATGTCCTATATGCTTAAGTATTAT
Genomic location of SSR565  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1238 marker 1238
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)