SGN Marker CT287

SGN-M124

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
0
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT287 image not available
Forward sequence
not available
Reverse sequence
TTTTTCTACGATGAAAATCGTAACCCTTACCGTGTGAAAGTCCGTGACTGTTTGGACAGTAAAAAAATGGGATTCGATTACGCGCCAATG
CCCACTCCATGGCGTAATTTTAAACCAATCAGAAAGTCATCATCAGGAAAAGTGAATACAGCGTCAATTGCACCAGTTAGCAAGGTGTTC
CCATTGGCGAAGCTGGACCGTGCGATTTCGTTCTCTATCACGCGGCCAGCCTCGTCAAGGACAACACAAGAGAAAAATGAGCAAGAGGAG
ATACTGACATTCAATAAAATATCGTATGATGATAGGAACTATGTAAGGTTCGATGTGTTTCTGAACGTGGACAAGACTGTGAATGCAGAT
GAGCTTGATAAGGCGGAGTTTGCAGGGAGTTATACTAGCTTGCCGCATGTTCATGGAAGTAATACTAATCATGTTACCAGT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1433613.1e-0540 (9.1% of RFLP seq)-
SGN-U1433615e-0755 (12.5% of RFLP seq)-
SGN-U1433631.3e-1094 (21.3% of RFLP seq)-
SGN-U1433632.5e-24168 (38.1% of RFLP seq)-
SGN-U1433612.6e-27101 (22.9% of RFLP seq)-
SGN-U1604847.9e-43124 (28.1% of RFLP seq)-
SGN-U1604843.3e-48132 (29.9% of RFLP seq)-
SGN-U1604851e-155405 (91.8% of RFLP seq)-
SGN-U143365436 (98.9% of RFLP seq)-
SGN-U143362441 (100.0% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53770)
Chromosome
8
Position
29.60 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
A

Carotene_content_car8_12_Methylthio_ethanol_content_meo8_1Hex_3_en_1_ol_content_x3o8_1 2_Phenylethanal_content_pea8_1 3_Methylthio_propanal_content_mta8_1
Tomato QTL map

Map: Eggplant-COSII   
Map version
63 (location: 42349)
Chromosome
8
Position
63.30 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39049)
Chromosome
8
Position
37.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8204)
Chromosome
8
Position
48.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8203)
Chromosome
12
Position
61.00 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8202)
Chromosome
4
Position
94.90 cM
Confidence
F(LOD3)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT287 was used as an overgo probe on plate 16 [well E10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTAACCCTTACCGTGTGAAAGTCC
B sequence
CTGTCCAAACAGTCACGGACTTTC
AB sequence
GTAACCCTTACCGTGTGAAAGTCCGTGACT
Marker sequence
TTTTTCTACGATGAAAATCGTAACCCTTACCGTGTGAAAGTCCGTGACTG
TTTGGACAGTAAAAAAATGGGATTCGATTACGCGCCAATGCCCACTCCAT
GGCGTAATTTTAAACCAATCAGAAAGTCATCATCAGGAAAAGTGAATACA
GCGTCAATTGCACCAGTTAGCAAGGTGTTCCCATTGGCGAAGCTGGACCG
TGCGATTTCGTTCTCTATCACGCGGCCAGCCTCGTCAAGGACAACACAAG
AGAAAAATGAGCAAGAGGAGATACTGACATTCAATAAAATATCGTATGAT
GATAGGAACTATGTAAGGTTCGATGTGTTTCTGAACGTGGACAAGACTGT
GAATGCAGATGAGCTTGATAAGGCGGAGTTTGCAGGGAGTTATACTAGCT
TGCCGCATGTTCATGGAAGTAATACTAATCATGTTACCAGT
Genomic location of CT287  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D124 marker 124
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)