SGN Marker TG384

SGN-M125

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CATGTGTTTGTTTGAAAAACGTTTCTCGCTCAGTGAAGGTTTGTAATGTTCATAATAGCCTCAGTTAATTCTTAATATTGGCTATTCGTG
CAATGATTTTGGCTGACAAACTACTTCACAGAATCTTAGTGCAGGTCTATTTATGAACGAGAGTTTTGTTGTTCCCTTGGTTCAGCTTTT
ATTTGATGATTTGACCTTTGTCCAGGTAATTTTTTTTTGTTTTTTTGTTTTTTGCTAGTGCTCTTCTAGGAACCTGTATTTGCAACTTTG
GCACCATAGCTGATGCTAGACTGATGGCTTTCATGCCCTATATGTTGTTGAGCATTATCCTCATAGAAGTTGTGTCGAGTGGTTTGAACT
TGTATGTTAGGCTGTGCTGGGTGTTGGTAAAATGAAGCTTAGGAGATCCTGATCTTTTGACAGCAATACTAATGATTCTT
Reverse sequence
CACAAAAGTGTTAAACCTCAAAAGGACACATCTCTGTATAACCATTACATTCCAGGCAACATATAATATCAAAAAAATTACCACAAATCA
GGCTTCTTAAGGTCAACTGTGTGAGTTCTGATAGAATTTCCTCTTTACACTTGTCACTCACAAGGAATGTTAGATTCCTTAAAGCACACA
CAGCTTTTACCCTAATAGTTGCATCCATTGACTTCGAAAGCTGAACAAGCTGCTTCAAACCTCCACATTTCATAAACATGGTCTTATGTG
CCAAGAAATCAACCACTATGTTGCTGATGGCATCAAGGGCAGAAACCTGGTAATAGAGGATTAAGGAACAAATTATGAATCCTCCATAAC
TCAACCTAAGAAAATTAGGACCACAAACGCAACAGATATTTTCAAGTCATGAGATACAGTATCTACTTGAACCAGTTGAAACAACAAGAA
TGAAAAAGGTGCATGTATGTA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1562471.4e-1338 (8.6% of RFLP seq)+
SGN-U1562472e-4388 (20.0% of RFLP seq)+
SGN-U1562472e-133239 (50.7% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53291)
Chromosome
11
Position
39.98 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_11 MQTL_1_Maturity_11 MQTL_2_Late_blight_11 MQTL_2_Maturity_11
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43864)
Chromosome
11
Position
61.60 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43607)
Chromosome
11
Position
45.90 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43326)
Chromosome
11
Position
45.60 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40867)
Chromosome
11
Position
59.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Pepper-AC99   
Map version
34 (location: 8209)
Chromosome
11
Position
28.09 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8208)
Chromosome
11
Position
45.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8210)
Chromosome
11
Position
66.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG384 was used as an overgo probe on plate 9 [well H11]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TTGGCACCATAGCTGATGCTAGAC
B sequence
GGCATGAAAGCCATCAGTCTAGCA
AB sequence
TTGGCACCATAGCTGATGCTAGACTGATGG
Marker sequence
CATGTGTTTGTTTGAAAAACGTTTCTCGCTCAGTGAAGGTTTGTAATGTT
CATAATAGCCTCAGTTAATTCTTAATATTGGCTATTCGTGCAATGATTTT
GGCTGACAAACTACTTCACAGAATCTTAGTGCAGGTCTATTTATGAACGA
GAGTTTTGTTGTTCCCTTGGTTCAGCTTTTATTTGATGATTTGACCTTTG
TCCAGGTAATTTTTTTTTGTTTTTTTGTTTTTTGCTAGTGCTCTTCTAGG
AACCTGTATTTGCAACTTTGGCACCATAGCTGATGCTAGACTGATGGCTT
TCATGCCCTATATGTTGTTGAGCATTATCCTCATAGAAGTTGTGTCGAGT
GGTTTGAACTTGTATGTTAGGCTGTGCTGGGTGTTGGTAAAATGAAGCTT
AGGAGATCCTGATCTTTTGACAGCAATACTAATGATTCTT
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG384  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D125 marker 125
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)