SGN Marker CT8

SGN-M126

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pCR1000
Cutting Site
HindIII/EcoR1
Drug Resistance
KN
Image
CT8 image not available
Forward sequence
TGAATTATTCGAGAATTGAGATGACACTACCAACACGAGGAGTTGTAAAATGGTTATTAACAATTGATACCACTAAATCTTCCGGGACAA
TGATATGTATCTGGGCGTAGAATCAAAGATCGAGGGTACAAACCAATTGAAGTCTGTCTCTTTACACCCACTGTCACACACTCTTACATC
CACCGGAAAAAATAGGGGAGGGAAAAGGAAAAAAAACAAATAACGATCACTCTGGAGAAATAAATT
Reverse sequence
TTTTTTTTTTCTTTCATCAAAATCCGTTGCCGATCTCTATAATTTCATTTCTTTTGCTTCTTCTTCTTGTTGGTGTTCTTGCCGATAATA
TATCAAGAAATGTGAATTTTGTGATATGCGCCATTTGTGACTTGAAATTTATTGGGTGGAGAGAAAGATTGAATCTTTTTCTCTATTTGA
TAATTGGGTCAAAGTGGGTTGCTTTCATATTTTGTAAAGGAGCAATGGAAATGGAGAACATTGAGTGTGTTTCAACAACTGATGGGATTG
AAGATGAAGAGATCCAGTTATCACATAATCAATTTTCTTCTGCAAAACCTCATAATATTCTTTTTCCCGGACTTGCCCCTACTAGTGTAC
ATGAATTGCTTGAATGCCCCGCTTGTACCAATTCTATGTATCCACCAATTCATCAGTGTCACAATGGGCACACACTTTGTTCTACCTGCA
AAAC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1461983.2e-0552 (11.5% of RFLP seq)-
SGN-U1621893.4e-1166 (14.5% of RFLP seq)-
SGN-U1477381.4e-1366 (14.5% of RFLP seq)-
SGN-U1477392.3e-1565 (14.3% of RFLP seq)-
SGN-U1626945.2e-44133 (29.3% of RFLP seq)-
SGN-U162693425 (93.6% of RFLP seq)-
SGN-U150346416 (91.6% of RFLP seq)-
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42360)
Chromosome
3
Position
70.30 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Eggplant-LXM 2002   
Map version
29 (location: 9235)
Chromosome
3
Position
77.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9234)
Chromosome
3
Position
55.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT8 was used as an overgo probe on plate 5 [well A1]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P186I02,   P075H11,   P031P17,   P031F16,   P021J08,   P330F07,   P048D15,   P006J14,   P327L04,   P252B12,   P327M04,   P049I14

 Overgo Sequences

A sequence
GTCTCTTTACACCCACTGTCACAC
B sequence
CGGTGGATGTAAGAGTGTGTGACA
AB sequence
GTCTCTTTACACCCACTGTCACACACTCTT
Marker sequence
TGAATTATTCGAGAATTGAGATGACACTACCAACACGAGGAGTTGTAAAA
TGGTTATTAACAATTGATACCACTAAATCTTCCGGGACAATGATATGTAT
CTGGGCGTAGAATCAAAGATCGAGGGTACAAACCAATTGAAGTCTGTCTC
TTTACACCCACTGTCACACACTCTTACATCCACCGGAAAAAATAGGGGAG
GGAAAAGGAAAAAAAACAAATAACGATCACTCTGGAGAAATAAATT
Genomic location of CT8  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D126 marker 126
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)