SGN Marker SSR590

SGN-M1263

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 41
Repeat motif: TC   Repeat number: 6
Repeat motif: AC   Repeat number: 4
Repeat motif:    Repeat number:
Forward primer: TCTCAAAGTCGTTCCTTCTTGA
Reverse primer: GGAAGAGAAACGCGGACATA
Predicted size: 161
Derivations 
This marker was derived from EST read SGN-E176165
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42999)
Chromosome
5
Position
37.40 cM
Confidence
uncalculated
Protocol
SSR


Tomato-LXCHM 2007

PCR data   Exp. ID 43999
Forward primer (5'-3')
TCTCAAAGTCGTTCCTTCTTGA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GGAAGAGAAACGCGGACATA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39269)
Chromosome
5
Position
107.50 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 75
Forward primer (5'-3')
TCTCAAAGTCGTTCCTTCTTGA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GGAAGAGAAACGCGGACATA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 161+161
Solanum lycopersicum LA925: 161+158
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
SSR590 was used as an overgo probe on plate 11 [well G7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCCATTCCACCTTTGCTTCACGCT
B sequence
AGAGAAACGCGGACATAGCGTGAA
AB sequence
TCCATTCCACCTTTGCTTCACGCTATGTCC
Marker sequence
GAATTAATTCTCTCAAAGTCGTTCCTTCTTGAGAAAAAAGAACACACACT
CTCTCTCTCTCCTCCATCCACCACCATTCACCACCACCATGGTCATATCC
AAGGCCGCCTCGGAGTCGGATCTCTCCGTCCATTCCACCTTTGCTTCACG
CTATGTCCGCGTTTCTCTTCCCCGGTTTAAGATGCCGGAGAATTCGATAC
CAAAGGATGCAGCATATCAAATAATAAATGATGAATTAATGTTGGATGGA
AATCCAAGGCTTAATTTAGCTTCATTTGTGACAACATGGATGGAACCAGA
ATGTGATAAGCTAATCATGGATTCAATTAACAAGAATTATGTTGACATGG
ATGAATACCCTGTCACCACTGAGCTTCAGAATCGATGTGTAAACATGATA
GCCCATTTATTTAATGCACCATTGGGAGAGGGAGAGGCTGCTGTTGGAGT
TGGAACAGTTGGATCCTCAGAAGCCATTATGCTTGCTGGATTAGCCTTTA
AGAGAAAATGGCAAAACAAAATGAAGGCCCAAGGAAAGCCTCATGACAAG
CCCAATATTGTTACTGGGGCCAATGTCCAGGTATGCTGGGAAAAATTTGC
GAGGTACTTCGAAGTAGAATTAAAAGAAGTGAAATT
Genomic location of SSR590  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1263 marker 1263
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)