SGN Marker SSR593

SGN-M1266

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45 High: 40
Repeat motif: TAC   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: TGGCATGAACAACAACCAAT
Reverse primer: AGGAAGTTGCATTAGGCCAT
Predicted size: 295
Derivations 
This marker was derived from EST read SGN-E95596
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 43000)
Chromosome
4
Position
13.90 cM
Confidence
uncalculated
Protocol
SSR


Tomato-LXCHM 2007

PCR data   Exp. ID 44000
Forward primer (5'-3')
TGGCATGAACAACAACCAAT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGGAAGTTGCATTAGGCCAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39270)
Chromosome
4
Position
15.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14097
Forward primer (5'-3')
TGGCATGAACAACAACCAAT
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGGAAGTTGCATTAGGCCAT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 162+293+295
Solanum pimpinellifolium LA1589: 160+295
Approximate temperature
55°C
  
PCR data   Exp. ID 58
Forward primer (5'-3')
TGGCATGAACAACAACCAAT
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAAGTTGCATTAGGCCAT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 285+295
Solanum lycopersicum LA925: 295+295
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
SSR593 was used as an overgo probe on plate 6 [well H6]

Plausible BAC Matches:   P054N05,   P024F23,   P076I13,   P011H06,   P193J06

 Overgo Sequences

A sequence
CGACAGCTTCATCACACATAGAGC
B sequence
CAAGGCATCACAAAAGGCTCTATG
AB sequence
CGACAGCTTCATCACACATAGAGCCTTTTG
Marker sequence
TTCACGTTTACCATAATATCTGTACGAAATTCACCTGCGGAGAAAGAGGA
TTACACGGTGGGAATCGAACCCCACCCACAAAATCTTCAAGAGTAACCAA
CTAACCGAACAACTAAAATTCTCCTTTTTCTTTTTTTTAGCTTGAGTTTG
TGTACTACTATTAGGAATTTAATTTATACATATTAACGCCTTGCACTTTC
CTTCTTTCTTGCTATCATATATATACATATTTCTTATATTGTCAGTATAT
ATAACTGTTTACCCTCGTATATATTCTTTTTTGTCGTGTTTACACAGGCG
CGACAGCTTCATCACACATAGAGCCTTTTGTGATGCCTTGGTTCAAGAAA
ATGCAAGAAATATCCTTTCACCAAACTCCTTGATGAACACCCTTGGCATG
AACAACAACCAATATTTATATGGAAGTAGTAGCAACATAAACTTAGGCAC
CTTCTCCAAATTGGGCAATAACAACAACATCACAAAGACTACTACTACTA
CTACAACTACTACTAGTGGTGTTCAATTTGATCATCATCATCATGACAAC
AACCTCATTGGATCAAGTACTACTACTACTACTACTACTAACAATCCCTT
TTTCCTTCAAGATACAAATCAAGATCATTACAATGCCAACAACAACAATA
TCAAACCATTAATGGTCCATGGCCTAATGCAACTTCCTAATCTTGATCAT
AACAACAACAATAGTAGTAGTAGTACTACTATGTTTAACCCTAACTTTTT
TCAAAACAATTTGTCTACCAATAGTGGAAATTTTGGG
Genomic location of SSR593  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1266 marker 1266
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)