SGN Marker SSR594

SGN-M1267

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 41 High: 41
Repeat motif: TCT   Repeat number: 8
Repeat motif:    Repeat number:
Forward primer: TTCGTTGAAGAAGATGATGGTC
Reverse primer: CAAAGAGAACAAGCATCCAAGA
Predicted size: 293
Derivations 
This marker was derived from EST read SGN-E98332
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49375)
Chromosome
8
Position
58.60 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47310)
Chromosome
8
Position
69.56 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39271)
Chromosome
8
Position
55.00 cM
Confidence
CF(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14131
Forward primer (5'-3')
TTCGTTGAAGAAGATGATGGTC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CAAAGAGAACAAGCATCCAAGA
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 287+293
Solanum lycopersicum LA925: 293
Approximate temperature
55°C
  
PCR data   Exp. ID 103
Forward primer (5'-3')
TTCGTTGAAGAAGATGATGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CAAAGAGAACAAGCATCCAAGA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 273+293
Solanum lycopersicum LA925: 293+293
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
SSR594 was used as an overgo probe on plate 12 [well C12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGCAGAAGATTACCCTTTGAGACC
B sequence
AGCAGCAACAGTTCCAGGTCTCAA
AB sequence
AGCAGAAGATTACCCTTTGAGACCTGGAAC
Marker sequence
TTCAAAATGAACTCACCATCAACAGCAACAAGAAGAAGAAGACCATGTTT
CGTTGAAGAAGATGATGGTCTTGTTTCTATAGCTGAAACTCAACCTGAGT
TCTCAGGCAATAATAATCAAAATCATATTAATAATAATAATAATAACAAT
AACAAGAATCATAATTTGATTTATAGACCTCTTTATTATTCAAGAAGAAA
TAGCATGAAGAATCACTCTTCTTCTTCTTCTTCTTCTTCTTATTCTTTGT
TGTCTCCAAGATCTGTTATTTCTGCTGGAAAATACTGTGATGGTAGATTT
GATGAACCCCATCACTATTTCTTGGATGCTTGTTCTCTTTGTAAGAAAAG
ACTTGGTGATAACAGTGACATCTTCATGTACAGAGGGGACACTCCATTCT
GTAGTGAAGAGTGTAGACAACAAGAAATAGAGAAGGATGAAGCTCAAGAT
AGAAAAAGAAACATTTCTTCTTTAAAAGCTATGAGAAAAAAGGAACAAAA
ACAACAATCAACATCTCCAAACAAAACTTCAGCAGAAGATTACCCTTTGA
GACCTGGAACTGTTGCTGCTGCTTGAGCAAAAAATGATAAATGAATCTAC
TTGGATGAAG
Genomic location of SSR594  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1267 marker 1267
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)