SGN Marker SSR596

SGN-M1269

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 45
Repeat motif: GA   Repeat number: 7
Repeat motif: TCGA   Repeat number: 2
Repeat motif:    Repeat number:
Forward primer: TTCGGATAAAGCAATCCACC
Reverse primer: TCGATTGTGTACCAACGTCC
Predicted size: 184
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43812)
Chromosome
10
Position
18.00 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44827
Forward primer (5'-3')
TTCGGATAAAGCAATCCACC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCGATTGTGTACCAACGTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43272)
Chromosome
10
Position
16.10 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44641
Forward primer (5'-3')
TTCGGATAAAGCAATCCACC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCGATTGTGTACCAACGTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40802)
Chromosome
10
Position
13.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39273)
Chromosome
10
Position
25.70 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14144
Forward primer (5'-3')
TTCGGATAAAGCAATCCACC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCGATTGTGTACCAACGTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 179+184
Solanum pimpinellifolium LA1589: 184+191
Approximate temperature
55°C
  
Genomic location of SSR596  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1269 marker 1269
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)