SGN Marker SSR598

SGN-M1271

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 43
Repeat motif: TTC   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: TGGAAAGAAGCAGTAGCATTG
Reverse primer: CAACGAACATCCTCCGTTCT
Predicted size: 186
Derivations 
This marker was derived from EST read SGN-E178456
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49376)
Chromosome
2
Position
40.44 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47311)
Chromosome
2
Position
86.57 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43813)
Chromosome
2
Position
13.70 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44828
Forward primer (5'-3')
TGGAAAGAAGCAGTAGCATTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CAACGAACATCCTCCGTTCT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43273)
Chromosome
2
Position
64.90 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44642
Forward primer (5'-3')
TGGAAAGAAGCAGTAGCATTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CAACGAACATCCTCCGTTCT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40803)
Chromosome
2
Position
60.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39274)
Chromosome
2
Position
78.00 cM
Confidence
CF(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 32116
Forward primer (5'-3')
TGGAAAGAAGCAGTAGCATTG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CAACGAACATCCTCCGTTCT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 186
Approximate temperature
43°C
  
Overgo hybridization and physical mapping 
SSR598 was used as an overgo probe on plate 12 [well D3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CGTCGTTGGAGAAAGACAGACTGT
B sequence
ACGACGCCGTTTAGTAACAGTCTG
AB sequence
CGTCGTTGGAGAAAGACAGACTGTTACTAA
Marker sequence
GGAAAGAGAGAGAGAGAGAATACTGGAAAGAAGCAGTAGCATTGTAAAGA
AGAAACATCTAGATATACTCTAGAATAACTAAAAGCCTGTTTTCTCTTTC
CTTTTTTCTTCTTCTTCTTCTTCTTCTTATCTCTCTCTCTACTGTTCTGT
CGTCTGCTCATTTTTATCTTTCAGTATGAGTAAGGAGAAAGAACGGAGGA
TGTTCGTTGGTGTTGTTTGGAATTGTGCTGCTGAGCTTAAGCTTCTTCTT
ACTGCTCTTCTTTTTCTCTGTTCTCTTATTACACTTCTTCACTTTATCCC
TTCTCGTTTAATCACTTTCTCCCCTGTAGATCTTGGCAGCTGTATTTCTA
CTCCCACCGCCCCACTTCACTTTGTTTCCCACTTAAACGCTACTAATTCA
TCAACCCCATCTGCTAATACGAGTACTACTACTCCACCGCCGGCACCGGA
GCCGCCGTCGTTGGAGAAAGACAGACTGTTACTAAACGGCGTCGTTAAGA
GAGCTTTCAACCCTTTTGGCTCCGCCGCGTACAACTTTATTCTGA
Genomic location of SSR598  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1271 marker 1271
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)