SGN Marker SSR603

SGN-M1276

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 55 High: 43
Repeat motif: GAA   Repeat number: 8
Repeat motif:    Repeat number:
Forward primer: GAAGGGACAATTCACAGAGTTTG
Reverse primer: CCTTCAACTTCACCACCACC
Predicted size: 251
Derivations 
This marker was derived from EST read SGN-E120148
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53501)
Chromosome
4
Position
45.29 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2009

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40806)
Chromosome
4
Position
38.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39278)
Chromosome
4
Position
37.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14098
Forward primer (5'-3')
GAAGGGACAATTCACAGAGTTTG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CCTTCAACTTCACCACCACC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 173+251
Solanum lycopersicum LA925: 179+250+251
Approximate temperature
50°C
  
PCR data   Exp. ID 59
Forward primer (5'-3')
GAAGGGACAATTCACAGAGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CCTTCAACTTCACCACCACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 251+251
Solanum pennellii LA716: 173+173
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR603 was used as an overgo probe on plate 9 [well E6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CATCCCTACTCCTTTGGGAATGAT
B sequence
CACTTGGCCTATTGGTATCATTCC
AB sequence
CATCCCTACTCCTTTGGGAATGATACCAAT
Marker sequence
GGTTTTCCCAATTACTTAAATCTTTTGGGAGAAAATAAGAAGGGACAATT
CACAGAGTTTGTCTATCATCATTAATCCCCTCTTGGGATTTTGACATAAT
TAAGGTTGATCACAATCATCTTGATTTTTCATTAATTTTCAAGAAGAAGA
AAACAATGAAAGAAATCATTGACAATAGTTTGATCAATGAAATTGAAGAA
GAAGAAGAAGAAGAAGAAGAGGGGAACTTTTATAATTCTACAAGTGATTT
GTTTGAAATTGATCATCATGGTGGTGGTGAAGTTGAAGGAAGTTTGTTTT
CCTTTGACTTTCACAATCATGAGGAACATGATGTTGTTTATGTTGTTGTT
TGGAATAAGAATGTTAGTCAAGAGGAATCAAGCATGGATGCTTTGCTTTG
GACTCTCAATCATGTTGTGACTAATCCAAATTCTACCATTGTTTTCCTCA
TTCATATATTTCCTCAAACTAACTTCATCCCTACTCCTTTGGGAATGATA
CCAATAGGCCAAGTGAATGAAGAGCAAAAAGAGAACTACATGACTAAAGA
AAGAAGCAAGAGGAGACAGTTCCTTCAAAAGTTTGTTG
Genomic location of SSR603  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1276 marker 1276
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)