SGN Marker SSR606

SGN-M1279

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 50
Repeat motif: CGG   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: TTCTTCGGAGACGAAGGGTA
Reverse primer: CCTTCAATCCTCCAGATCCA
Predicted size: 166
Derivations 
This marker was derived from EST read SGN-E123100
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 43001)
Chromosome
10
Position
0.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-LXCHM 2007

PCR data   Exp. ID 44001
Forward primer (5'-3')
TTCTTCGGAGACGAAGGGTA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CCTTCAATCCTCCAGATCCA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39280)
Chromosome
10
Position
3.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31777
Forward primer (5'-3')
TTCTTCGGAGACGAAGGGTA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CCTTCAATCCTCCAGATCCA
Enzymes
  
Accessions and product sizes
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR606 was used as an overgo probe on plate 15 [well E7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTTATGATGCTGCAGCTCGAACTC
B sequence
GCTTTAGGTCCACGAAGAGTTCGA
AB sequence
CTTATGATGCTGCAGCTCGAACTCTTCGTG
Marker sequence
GCTTTCTTCTTTTCTCTCTCTAAAATTCTCATCCAAAAACGACCACACAA
TACAGTAGAGAGAGAAAATCAAATCGAAGATTTTACAGAAGGATATCGAG
TTTCTTCGGAGACGAAGGGTAGCTTAATCCTCCATTCGATCTCAAAAGGG
GAGGTGTGATTTTTTTATTTTTTATTTTAAAATAATTTTTGGATATGAGA
AGAGGCAGAGCAACTCCGGCGGCGGCGGCGGCGGCGGTGAAGCCAGATGG
ATCTGGAGGATTGAAGGAGATTAGGTTTCGTGGAGTTCGGAAGAGGCCAT
GGGGGAGATTTGCTGCAGAGATTAGAGATCCATGGAAGAAAACTAGGGTT
TGGTTAGGTACTTTTGATTCAGCTGAAGATGCTGCCAAAGCTTATGATGC
TGCAGCTCGAACTCTTCGTGGACCTAAAGCTAAAACTAATTTCCCTTTAC
CTATGTATTCTCAGCATCATCAGTTCAATCGAAGTTTAAACCCTAATGAT
CGGTTAGTTGACCCGAGATTGTACTCACAAGAAGCTCCGATCATTTGTCA
AAGACCTACATCGAGCAGTATGAGTAGTACTGTGGAATCATTCAGTGGAC
CGAGA
Genomic location of SSR606  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1279 marker 1279
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)