SGN Marker TG388

SGN-M128

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG388 image not available
Forward sequence
CGATTATACAGAGAAAGAAGAACTTAATATTATAATAAATTAGATGACTGAAACCTATGTATTATAGTACTGCATACCTTTCTTAACTTC
CCTTCATCAACAAACTTTCTCCGAGGGGCCTGAATGGTTGAATTGACAGTTGATCGTGGAGAGTTATCAGCACCAGCCACAGATGCATTA
GTACCATTTTGCTGAAAATTTCTACAAACTGGAGGTGGAACCACTCCTGACAACTGCAAAGAAATTGTATTTTACAAACTTTCGAAAAAT
CAAAAAGAAATTCTAGTGTTGCCAAAGTGCATATAAGAATGTCAGTTGATTCTTTAATATAGAAGATTGTCACCTTTACATATTGTTTAG
CCAAGCTTTTGGAAGGGCCAAAAGTGCTTCTTCTTGTTTTTAAAAAAGTGTGTATGTTTAAAAAAGTGAGTTGTTTAACCAAGCTATGAG
GAGA
Reverse sequence
ATTATCCTGAGTGAGACATGCTTCTCTAGATTGTCCTTTGTACCAAGCAATACACCCTTACCATTCTAAAATAAATGGTGACAATGTATT
TGTTAGTTAGATCATAGTTTCTTAGATTGAGGAAGAGGGTAGCAATCAGAGAATTTGACTCTAATTTAAAGCAGATTGCAAGTTTTGAAG
AGGACAGAAAATATCTAATTTATTGTCAATCCGATGGAGTCTAAAATGTCTTCTCCGGTTTAAAACATAGTTGGTAACTTTCTAATGATA
TCTGTATAGTTTCACAGAGCTATGTTCTTGTTAATTGAAGTGAAATTAATAGCCTTTTTGGCCTAGCTTCTAAAATGAGTTTATTTTGAG
AAGTGCTTTTCTAAAAAGTACTTTTGGTGACAACCAGTTTGTGACTTTGCTTTGTGAGAAGCAGTTTGTGTTTGACCATGTTTTTAACAA
GTTCTTCTAAGTGTATTTTC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1724671.4e-47107 (23.6% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8217)
Chromosome
3
Position
55.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8218)
Chromosome
3
Position
48.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG388 was used as an overgo probe on plate 5 [well F6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTACAAACTGGAGGTGGAACCACT
B sequence
CTTTGCAGTTGTCAGGAGTGGTTC
AB sequence
CTACAAACTGGAGGTGGAACCACTCCTGAC
Marker sequence
CGATTATACAGAGAAAGAAGAACTTAATATTATAATAAATTAGATGACTG
AAACCTATGTATTATAGTACTGCATACCTTTCTTAACTTCCCTTCATCAA
CAAACTTTCTCCGAGGGGCCTGAATGGTTGAATTGACAGTTGATCGTGGA
GAGTTATCAGCACCAGCCACAGATGCATTAGTACCATTTTGCTGAAAATT
TCTACAAACTGGAGGTGGAACCACTCCTGACAACTGCAAAGAAATTGTAT
TTTACAAACTTTCGAAAAATCAAAAAGAAATTCTAGTGTTGCCAAAGTGC
ATATAAGAATGTCAGTTGATTCTTTAATATAGAAGATTGTCACCTTTACA
TATTGTTTAGCCAAGCTTTTGGAAGGGCCAAAAGTGCTTCTTCTTGTTTT
TAAAAAAGTGTGTATGTTTAAAAAAGTGAGTTGTTTAACCAAGCTATGAG
GAGA
Genomic location of TG388  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D128 marker 128
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)