SGN Marker TM15

SGN-M1285

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from a(n) EST read (ID unknown)
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40148)
Chromosome
7
Position
104.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
TM15 was used as an overgo probe on plate 7 [well B10]

Plausible BAC Matches:   P335L02,   P104D04,   P175E15,   P321D23,   P053K10,   P120P15,   P283K19,   P139A03,   P176G09,   P309F18,   P101J20,   P019J16,   P098L17,   P101B16,   P176E17

 Overgo Sequences

A sequence
AAAGTCCAGGGCATCTGTTGCTTC
B sequence
CTCTGCCAAAGCTTGAGAAGCAAC
AB sequence
AAAGTCCAGGGCATCTGTTGCTTCTCAAGC
Marker sequence
NCAGCTCGAATAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC
GGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGG
CACGAGGTTCTTTTGTTATTGTTAGTATTTTTGTTTAGCTGTTCTTTCAT
TTCAATTTTCATTAATGGCGGAATCAAAGGATTGTCATGTTATCGTTGAA
ATTCCGGTTGATGAAGAGCATCAGCTTAAACTTTCTTCGGGTATTACTAC
TATAACTGCGATTCAAAACCATCCATTGATGGAAATCTCAAAAAGTCCAG
GGCATCTGTTGCTTCTCAAGCTTTGGCAGAGAGAAGAGGATCTCTCTGGC
CGCAGAATTGCGGCCAAAGAGGCACGAATGGACAGTATTAGGAGAGAAAT
ATTTCAGATCTGTTGTTTTTTCTTTATATTTCATGCTCTGTTTTTTACGA
TTCTGTTCACCTCTGTTTCTGAGGACCACCTTGATGGTAAGGTTATGTGT
CAAAAATGGTGGATTCCTTCGATTCTATCAGTTTGTACTTCGTTTTGTAT
TGTGTTTTTGGTGCAGGTGAA
Genomic location of TM15  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1285 marker 1285
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)