SGN Marker TM24

SGN-M1289

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from a(n) EST read (ID unknown)
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40157)
Chromosome
11
Position
65.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
TM24 was used as an overgo probe on plate 9 [well H12]

Plausible BAC Matches:   P005P10,   P305B18,   P115F19,   P242P10,   P250O13,   P248N09,   P072I13,   P308K08,   P317E13,   P335N11

 Overgo Sequences

A sequence
CAGTAATCGGAGATGGCAGGAAGA
B sequence
ACCGTACCAGATCTACTCTTCCTG
AB sequence
CAGTAATCGGAGATGGCAGGAAGAGTAGAT
Marker sequence
NNNNNNNNNNNNNNNNNNNNGNNNNNNNNNGNGGNNCGANCCTCGAATTA
CCCTCGCTAAGGGACAAAAGCTGGCAGCTCCACCGCNGTGGCGGCCGCTC
TAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGGCACGAGGCTTCAAA
AAAATTGTAGTGAGAGAGGATTTGCAGTAATCGGAGATGGCAGGAAGAGT
AGATCTGGTACGGTAATCCCATTAAGCAGATTACGATATGCATGATTGGT
GCCGGTGGATTCATTGGTTCTCATCTATGTGAGAAGCTTCTGTCGGAGAC
TCCTCATAAGGTGCTTGCTGTCGATGTTTACAGTGGATAAGATTAAGCAT
TTGCTTGAACCGGCGACGGTTACTTGGGCTGATCGAATTCAGTTTCATCG
AATCAATATTAAGAATGATTCTCGCCTTGCAAGGTCTCATCAAAATGGCA
GATCTGACCATAAATCTTGCTGCGATCTGCACACCAGCAGATTACAACAC
TCGNCCACTTGGATACAATTTACNGCAATTTCATCGATGCTCTACCAAAT
GGTCAAGNACTGCNTCAGAAAATGGAAAGCGTCTCATTCACTTNCTCAAC
TTGTGAAGTTTTNTGG
Genomic location of TM24  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1289 marker 1289
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)