Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

SGN Marker TM20

SGN-M1290

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from a(n) EST read (ID unknown)
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51046)
Chromosome
2
Position
40.44 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48982)
Chromosome
2
Position
86.34 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40153)
Chromosome
2
Position
78.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
TM20 was used as an overgo probe on plate 11 [well B9]

Plausible BAC Matches:   P247J04,   P193F03,   P127I13,   P080H20,   P146K09,   P152I04,   P236H12,   P076J09,   P218I18,   P171P22,   P190D17,   P172H10,   P183A08,   P288M24,   P016D03,   P282G08,   P219I15,   P026L22,   P165F17,   P139B08,   P218L13,   P084B10,   P162K01,   P014N13,   P221D04,   P220I12,   P193H01,   P239E11

 Non-Plausible BAC matches

P161D15,   P166L04,   P122C17,   P108N23,   P297N12,   P275A18,   P296M01,   P249H24,   P167D12,   P122C10,   P010L09,   P179G01,   P030F10,   P027H15,   P161D16,   P163M15,   P165F11,   P156J17,   P162P08,   P077K10,   P076F20,   P076M13,   P180E09,   P299K19,   P154M19,   P203M11,   P026G09,   P244O09,   P108K21,   P244N07

 Overgo Sequences

A sequence
AACGGAGGATGTTCGTTGGTGTTG
B sequence
GCAGCACAATTCCAAACAACACCA
AB sequence
AACGGAGGATGTTCGTTGGTGTTGTTTGGA
Marker sequence
GGNCGACGCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGC
GGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGGCACGAG
GGAAAGAGAGAGAGAGAGAATACTGGAAAGAAGCAGTAGCATTGTAAAGA
AGAAACATCTAGATATACCTCTAGAATAACCTAAAAGCCTGTTTTCTCTT
TCCTTTTTTCTTCTTCTTCTTCTTCTTCTTATCTCTCTCTCTACTGTTCT
GTCGTCTGCTCATTTTTATCTTTCAGTATGAGTAAGGAGAAAGAACGGAG
GATGTTCGTTGGTGTTGTTTGGAATTGTGCTGCTGAGCTTAAGCTTCTTC
TTACTGCTCTTCTTTTTCTCTGTTCTCTTATTACACTTCTTCACTTTATC
CCTTCTCGTTTAATCACTTTCTCCCCTGTAGATCTTGGCAGCTGTATTTC
TACTCCCACCGCCCCACTTCACTTTGTTTCCCACTTAAACGCTACTAATT
CATCAACCCCATCTGCTAATACGAGTACTACTACTCCACCGCCGGCACCG
GAG
Genomic location of TM20  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1290 marker 1290
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)