SGN Marker TM27

SGN-M1294

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from a(n) EST read (ID unknown)
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40160)
Chromosome
1
Position
31.60 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
TM27 was used as an overgo probe on plate 9 [well B6]

Plausible BAC Matches:   P189O03,   P268J22,   P152B20,   P213A17,   P253O07,   P066P04,   P315N13,   P055M05,   P113L22,   P072D06,   P248G24,   P171N04,   P310N03,   P270H10,   P126F09,   P028N15,   P155L08,   P263H15,   P011N04,   P335C06,   P284N13

 Overgo Sequences

A sequence
TGTTGGGTTTTTGAGGGATACACG
B sequence
AACGAGCAAAGGTGCACGTGTATC
AB sequence
TGTTGGGTTTTTGAGGGATACACGTGCACC
Marker sequence
AAGCTNGAATTTANCCCTCACNAAGGGAACAAAAGCTGGAGCTCCACCGC
GGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGG
CACGAGGCGAGATGGTGGGTACAGAAGAACGTTAGAGATTTCTGGCCTCA
TGTTAAAATTAAGTATATAGCTGTTGGTAATGAAATCAGCCCTGTTACTG
GCACTTCCAATCTTGCCCCATTTCAAGTTCCTGCTTTGGTTAACATTTAC
AAAGCAATCGGTGAAGCTGGTTTGGGAAATGACATTAAGGTCTCAACGTC
TGTAGACATGACGTTGATTGGCAATTCTTATCCACCATCACAGGGTTCAT
TTAGGAACGATGTTAGATGGTTTACTGATCCAATTGTTGGGTTTTTGAGG
GATACACGTGCACCTTTGCTCGTTAACATTTATCCTTATTTTAGCTATTC
TGGTAATCCAGGACAGATTTCACTTCCGTATGCTCTTTTTACAGCACCTA
ATGTAGTGGTACAAGATGGATCGCGTCAATATAGGAACTTATTTGATGCT
ATGTTGGANTCTGCTTATGCTGC
Genomic location of TM27  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1294 marker 1294
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)