SGN Marker TM31

SGN-M1298

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from a(n) EST read (ID unknown)
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51049)
Chromosome
4
Position
63.42 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48985)
Chromosome
4
Position
132.33 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40164)
Chromosome
4
Position
137.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
TM31 was used as an overgo probe on plate 6 [well C11]

Plausible BAC Matches:   P219H08

 Overgo Sequences

A sequence
ATGCCATGGCACTTGAAGTGTTGC
B sequence
CCATCATCACCACCAAGCAACACT
AB sequence
ATGCCATGGCACTTGAAGTGTTGCTTGGTG
Marker sequence
CAATACCCTCCTAAGGGAACAAAGCTGGAGCTCCACCGCGGTGGCGGCCG
CTCTAGAACTAGTGGATCCCCCGGGCTGCAGGCACAAAAGCAACAACAAG
AAGCATATTAATAAACAATGGCCACTGTTACCTCTGCTGCTGTTGCTATT
CCATCTTTCACTGGCCTTAAGGCTGGTGCTTCATCATCTTCCAGAGTTAG
CACCGGTGCATCCGCTAAGGTGGCAGCTGCCCCAGTTGCCAGATTGACTG
TGAAGGCGTCTTTGAAAGATGTCGGTGCTGTGGTTGCTGCCACCGCTGTT
AGCGCGATGCTTGCTAGCAATGCCATGGCACTTGAAGTGTTGCTTGGTGG
TGATGATGGGAGTCTAGCTTTTATTCCTGGAAACTTCAGCGTTAGTGCTG
GTGAGAAAATTACATTCAAGAACAATGCAGGGTTCCCACACAACGTCGTA
TTTGATGAAGATGAAATCCCAGCTGGTGTGGATGCTAGTAAGATTTCCAT
GTCTGAAGAGGATCTTCTGAATGCAGCAGGAGAGACATACAGTGTCACTT
TGAGTGAGAAAGGAACTTACACTTTCTACTGTGCACCTC
Genomic location of TM31  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1298 marker 1298
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)