SGN Marker TG510

SGN-M13

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2100
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
ACTACTTCCTCTATGTATAAGAGAACATCAGTTAATGATTGAGGATGGTGATGCTCGCTAATCCCTACCGTATTCTGTGAAACTGAACCA
AGTTTTAGCCCATGCCCCGAAGCCATCACTTCTCTAGCAGTTTCTTGAACCAAGTCATCTTCTTCTCTGATAACAAACAGCTTGAAGGCA
TCGGAATCTTTTGCTAAGTTCCCCAAGTAACTCCCTGTCCAATTAGCCATGGGGAGATCAGTCATCACAAATACATGGATCTGTTTCTGT
CCTGTTTGCCTCAAAGATTCTAGTTTCTGCTTCAGACCAAGAAAAGTAGCTTTATGGTGGTTCTTGAATTGTCCATCTAGTAGCCTGAGC
TGTGCACAAAGAAAGGGACCCTTGATAGTTTGAAGAGCAAACTTCTTGCCGGCATTTATTATTTCAGGCACAAAGGGAAGGAACTCTATC
TTTTTGATTAAGGTCTGTACGATGGGATTATTAGGAGCTTCATGAATGTCAATATGGGATTCAGATCCCTTATAAGGAGCAGTGAAAAGG
CTTCCAAATGCCAAAACAGTGGCTGATTCTGCGGCAGAACCAGGGCCA
Reverse sequence
AGAAGTTCATGTGGTATGCGCCTCACAGTGGGTTCAGCAACCAATTGGCTGAGTTCAAGAATGCGATTTTGATGGCTAAGATTCTAAATC
GGACCCTAATTGTACCACCCGTGTTGGATCACCATGCTGTTGCGCTTGGTAGTTGTCCTAAATTTAGGGTTTTGGAACCTAATGAATTGA
GATACTTGGTTTGGAATCATAGTATTCAGCTCTTGCGTGATTGCAGGTAATTTTGAAATTTTTATCAGTTCATAACAACCTCTTTAGCTT
TAGCTCACTAAATAGAAAGAATCAATTTTTATGCTGTTCTTTGTGTTTGTGAATATGTCTGACTGAATTATGTAGAGTCAAATTGTTGCT
AATGTTCTTTTCTCCACGGCTTCTTCACTACTGTATTCCCTTTCCGTACCTGCTTTGAAATGCTCTACTTGAGAGATTTACTACTGTATT
CCCTTTTATGTACATGCTTTGAAATGCTTTACTTGAATCGAGGCTCTGTCCTTTCACAAGGTAGAGGTAAAGTATGCGTGGACACCACCC
TCCCCGGATCCCACTTATTGTTGTTATAATATTTGGAG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U166618558 (94.9% of RFLP seq)+
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 43020)
Chromosome
8
Position
27.80 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 44020
Forward primer (5'-3')
AGGATGGTGATGCTCGCTAA
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
GCCGCAGAATCAGCCAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper Capsicum   
Map version
65 (location: 42841)
Chromosome
1
Position
26.60 cM
Confidence
uncalculated
Protocol
RFLP


Pepper Capsicum

Map: Eggplant-COSII   
Map version
63 (location: 42479)
Chromosome
8
Position
90.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Pepper-COSII   
Map version
58 (location: 41634)
Chromosome
1
Position
46.20 cM
Confidence
I
Protocol
RFLP


Pepper-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40070)
Chromosome
8
Position
57.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Pepper-FAO3   
Map version
31 (location: 7732)
Chromosome
8
Position
35.44 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-FAO3

Map: Eggplant-LXM 2002   
Map version
29 (location: 7730)
Chromosome
8
Position
69.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7729)
Chromosome
8
Position
61.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Other PCR data 
PCR data   Exp. ID 14016
Forward primer (5'-3')
ATGGTGATGCTCGCTAATCC
Digested band sizes (using DpnII)
Solanum pennellii LA716: 400+900
Solanum lycopersicum LA925: 380+1100
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CTCTTGCGTGATTGCAGGTA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1800
Solanum lycopersicum LA925: 1800
Approximate temperature
60°C
  
PCR data   Exp. ID 14016
Forward primer (5'-3')
ATGGTGATGCTCGCTAATCC
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 380+1100
Solanum pennellii LA716: 400+900
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CTCTTGCGTGATTGCAGGTA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1800
Solanum pennellii LA716: 1800
Approximate temperature
60°C
  
PCR data   Exp. ID 14132
Forward primer (5'-3')
ATGGTGATGCTCGCTAATCC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CTCTTGCGTGATTGCAGGTA
Enzymes
  
Accessions and product sizes
Approximate temperature
55°C
  
PCR data   Exp. ID 104
Forward primer (5'-3')
Unknown
Digested band sizes (using DpnII)
Solanum pennellii LA716: 400+900
Solanum lycopersicum LA925: 380+1100
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1800
Solanum lycopersicum LA925: 1800
Approximate temperature
60°C
  
Overgo hybridization and physical mapping 
TG510 was used as an overgo probe on plate 11 [well H11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGAGGATGGTGATGCTCGCTAATC
B sequence
CACAGAATACGGTAGGGATTAGCG
AB sequence
TGAGGATGGTGATGCTCGCTAATCCCTACC
Marker sequence
ACTACTTCCTCTATGTATAAGAGAACATCAGTTAATGATTGAGGATGGTG
ATGCTCGCTAATCCCTACCGTATTCTGTGAAACTGAACCAAGTTTTAGCC
CATGCCCCGAAGCCATCACTTCTCTAGCAGTTTCTTGAACCAAGTCATCT
TCTTCTCTGATAACAAACAGCTTGAAGGCATCGGAATCTTTTGCTAAGTT
CCCCAAGTAACTCCCTGTCCAATTAGCCATGGGGAGATCAGTCATCACAA
ATACATGGATCTGTTTCTGTCCTGTTTGCCTCAAAGATTCTAGTTTCTGC
TTCAGACCAAGAAAAGTAGCTTTATGGTGGTTCTTGAATTGTCCATCTAG
TAGCCTGAGCTGTGCACAAAGAAAGGGACCCTTGATAGTTTGAAGAGCAA
ACTTCTTGCCGGCATTTATTATTTCAGGCACAAAGGGAAGGAACTCTATC
TTTTTGATTAAGGTCTGTACGATGGGATTATTAGGAGCTTCATGAATGTC
AATATGGGATTCAGATCCCTTATAAGGAGCAGTGAAAAGGCTTCCAAATG
CCAAAACAGTGGCTGATTCTGCGGCAGAACCAGGGCCA
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG510  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D13 marker 13
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)