SGN Marker TG314

SGN-M130

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TAGCAGATCATACGCATACCAATTTCACATTTAATCACGCCAATTTTATGAGGTGGATCAACATGCAGCTGAAACTAAAATAATATAAGA
ACCTAAACGAGAAAAAACTGGCAGATCGATTGGCCTTGAAAGAAAATTAAGTTCGGACTTAGTATAAATATATAGTTTGGAGAAGTTCCA
AATTATATTTCTTGTGTTCAATCATACGCATACCATTTCGCAATCAATCACACCAATAAACTAAAATTGTTAATCTATGAGATTCAAAAC
AACTGGTAAATCGATCAGCCCGAAATGAAAAAATTAAGTTGCAAAGTATGTCAGTACCAAATCGATCTTCATCATTGAGGCGCTGATGTT
GAGTGATTTTTCCAGCTGAAGAATTTAGGGTTTTTGGTGGATGATTAACAGCGGATTTGAATTTTCGCCTCATTATGTTGTGATGAT
Reverse sequence
AGTGCAAGAAAACTAAACAATCAACTAAAAGGAAATGAAATTAAGAAAATCAGTGAATGCAAAATGGTATGAAGTAATTGCATTAGACGT
TGAGGCTCAACATCCTCTGCGCGTGATTTAAAAATATCATTGTAACATCTGTATACCTAGAAGGTTCCTTGCATAATAGTTCTTTGTGTT
GAAGCATGAAGTATAATTTCATTAGACGTTGAGGCTCAACATCCTATGCGCATGAGTTAAGGATATCAATGTTGATAACCTAGAAAGTTC
TTTACTGGAAAAGATAGAAAATACTTATGCATTAGAGGGCGAGATCATATGGAAAGTAATAAAAAGAAAATGGACTAAAATTGCTTATTT
TCTGTTATATATAATACTTTTGAAAGTGTTTTCTTAATTTCTTTCTAAAATTAAGTGGCAATTTTCATTAAAAATATATTTTTTTGTAAA
ATTGATTTTTCAAAACTATAG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53884)
Chromosome
6
Position
86.20 cM
Confidence
uncalculated
Protocol
RFLP

3_Methylthio_propanal_content_mta6_1 2_Isobutylthiazole_content_ibt6_1
Tomato QTL map

Map: Sun1642 x LA1589   
Map version
85 (location: 43856)
Chromosome
6
Position
83.20 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43598)
Chromosome
6
Position
80.90 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43317)
Chromosome
6
Position
89.50 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40857)
Chromosome
6
Position
83.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39993)
Chromosome
6
Position
101.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8226)
Chromosome
6
Position
94.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8229)
Chromosome
6
Position
89.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG314 was used as an overgo probe on plate 2 [well E10]

Plausible BAC Matches:   P098J10,   P239F15,   P224N10

 Overgo Sequences

A sequence
GAACCTAAACGAGAAAAAACTGGC
B sequence
CAAGGCCAATCGATCTGCCAGTTT
AB sequence
GAACCTAAACGAGAAAAAACTGGCAGATCG
Marker sequence
TAGCAGATCATACGCATACCAATTTCACATTTAATCACGCCAATTTTATG
AGGTGGATCAACATGCAGCTGAAACTAAAATAATATAAGAACCTAAACGA
GAAAAAACTGGCAGATCGATTGGCCTTGAAAGAAAATTAAGTTCGGACTT
AGTATAAATATATAGTTTGGAGAAGTTCCAAATTATATTTCTTGTGTTCA
ATCATACGCATACCATTTCGCAATCAATCACACCAATAAACTAAAATTGT
TAATCTATGAGATTCAAAACAACTGGTAAATCGATCAGCCCGAAATGAAA
AAATTAAGTTGCAAAGTATGTCAGTACCAAATCGATCTTCATCATTGAGG
CGCTGATGTTGAGTGATTTTTCCAGCTGAAGAATTTAGGGTTTTTGGTGG
ATGATTAACAGCGGATTTGAATTTTCGCCTCATTATGTTGTGATGAT
Genomic location of TG314  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D130 marker 130
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)