SGN Marker TM5

SGN-M1304

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from a(n) EST read (ID unknown)
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40177)
Chromosome
2
Position
2.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
TM5 was used as an overgo probe on plate 10 [well G2]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
ATTGCTAGCAACGGTGGAAGAGTC
B sequence
ACACCTGCATGCAACTGACTCTTC
AB sequence
ATTGCTAGCAACGGTGGAAGAGTCAGTTGC
Marker sequence
NGNNCGACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGC
GGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGGGCTTCCTCTATA
GTTTCTTCAGCTGCTGTTGCCACCCGCGGCAATGGTGCACAAGCTAGCAT
GGTTGCACCCTTCACTGGACTCAAGTCCACTGCTTCTTTCCCTGTTTCAA
GGAAGCAAAACCTTGACATTACCTCCATTGCTAGCAACGGTGGAAGAGTC
AGTTGCATGCAGGTGTGGCCACCAATTAACATGAAGAAGTACGAGACTCT
GTCGTACCTTCCTGATTTGTCCGACGAGCAATTGCTCAGCGAAATTGAGT
ACCTATTGAAAAATGGATGGGTTCCTTGCTTGGAATTCGAGACTGAGCAC
GGATTTGTGTACCGTGAGAAGAGCGGGCGCAAAGGTCACTTGAATGTTGC
AACTGAGATTTATGAGGTGGCACCTTCACTCTACATGGTTGAGCTTCGCA
AGGCTGGAGGAGATACCTTGGAGTTTCACAAGTTTTACAAGAACCTGTCC
ACCGGATTGAAAGACATTGTTTGGCAATTGGGGGATGAAGCA
Genomic location of TM5  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1304 marker 1304
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)